Chromosome
Position
Variation ID
Gene
Function refgene
Gene UTR details
More details
chr12 175764 rs7959974 IQSEC3 UTR3 NM_001170738:c.*731C>T IQSEC3
chr12 175861 rs7960096 IQSEC3 UTR3 NM_001170738:c.*828C>A IQSEC3
chr12 176650 rs751662274 IQSEC3 UTR3 NM_001170738:c.*1617G>A IQSEC3
chr12 176772 rs116609263 IQSEC3 UTR3 NM_001170738:c.*1739T>C IQSEC3
chr12 177165 rs216232 IQSEC3 UTR3 NM_001170738:c.*2132A>G IQSEC3
chr12 177335 rs150553743 IQSEC3 UTR3 NM_001170738:c.*2302_*2308delCCTGTTG IQSEC3
chr12 177663 rs111584115 IQSEC3 UTR3 NM_001170738:c.*2630C>T IQSEC3
chr12 177848 rs199834962 IQSEC3 UTR3 NM_001170738:c.*2815delG IQSEC3
chr12 178107 rs774349667 IQSEC3 UTR3 NM_001170738:c.*3074_*3077delGCCT IQSEC3
chr12 178179 rs146368619 IQSEC3 UTR3 NM_001170738:c.*3146G>A IQSEC3
chr12 178201 rs72413404 IQSEC3 UTR3 NM_001170738:c.*3168_*3169delTC IQSEC3
chr12 178253 rs183344004 IQSEC3 UTR3 NM_001170738:c.*3220T>A IQSEC3
chr12 178307 rs12827 IQSEC3 UTR3 NM_001170738:c.*3274G>A IQSEC3
chr12 190376 rs1051104 SLC6A12 UTR3 NM_001206931:c.*692C>T SLC6A12
chr12 190549 rs542736 SLC6A12 UTR3 NM_001206931:c.*519T>C SLC6A12
chr12 190721 rs2075228 SLC6A12 UTR3 NM_001206931:c.*347G>A SLC6A12
chr12 190815 rs114580725 SLC6A12 UTR3 NM_001206931:c.*253G>A SLC6A12
chr12 191000 rs80064579 SLC6A12 UTR3 NM_001206931:c.*68G>A SLC6A12
chr11 196912 rs3825076 ODF3 UTR5 NM_001286136:c.-393C>G ODF3
chr11 196944 rs11604127 ODF3 UTR5 NM_001286136:c.-361C>T ODF3
chr11 203235 rs73386640 BET1L UTR3 NM_016526:c.*2235T>C BET1L
chr11 203788 rs2280543 BET1L UTR3 NM_016526:c.*1682G>A BET1L
chr11 204062 rs2280544 BET1L UTR3 NM_016526:c.*1408A>G BET1L
chr11 204208 rs111689552 BET1L UTR3 NM_016526:c.*1262C>T BET1L
chr11 204228 rs1045454 BET1L UTR3 NM_016526:c.*1242C>T BET1L
chr11 204524 rs57995069 BET1L UTR3 NM_016526:c.*946_*941delAGAAAT,NM_001098787:c BET1L
chr11 204968 rs12785943 BET1L UTR3 NM_016526:c.*502C>T BET1L
chr11 204986 rs4980319 BET1L UTR3 NM_016526:c.*484G>T BET1L
chr11 205021 rs72878027 BET1L UTR3 NM_016526:c.*449G>C BET1L
chr11 205113 rs11551933 BET1L UTR3 NM_016526:c.*357A>G BET1L
chr11 205198 rs3782123 BET1L UTR3 NM_016526:c.*272G>T BET1L
chr11 207337 rs867189746 BET1L UTR5 NM_016526:c.-16G>T BET1L
chr11 207359 rs71286246 BET1L UTR5 NM_016526:c.-39_-38insACGTCTGAGGCGGCTGTGGCC,N BET1L
chr11 207384 rs374402012 BET1L UTR5 NM_016526:c.-63C>T BET1L
chr11 207388 rs368841854 BET1L UTR5 NM_016526:c.-67A>G BET1L
chr11 207400 rs71487219 BET1L UTR5 NM_016526:c.-79T>C BET1L
chr11 207410 rs58692051 BET1L UTR5 NM_016526:c.-89G>A BET1L
chr11 207694 rs373475006 RIC8A UTR5 NM_001286134:c.-1161del-,NM_021932:c.-1161del RIC8A
chr11 207698 rs56186913 RIC8A UTR5 NM_001286134:c.-1157C>T RIC8A
chr11 208213 rs80168555 RIC8A UTR5 NM_001286134:c.-642C>T RIC8A
chr11 208741 rs528409188 RIC8A UTR5 NM_001286134:c.-114C>T RIC8A
chr11 214421 rs3216 RIC8A UTR3 NM_001286134:c.*71G>C RIC8A
chr11 214544 rs10081 RIC8A UTR3 NM_001286134:c.*194C>T RIC8A
chr11 214646 rs371654529 RIC8A UTR3 NM_001286134:c.*296G>C RIC8A
chr11 214716 rs500840 RIC8A UTR3 NM_001286134:c.*366G>A RIC8A
chr11 215364 rs570591 SIRT3 UTR3 NM_012239:c.*1334T>C SIRT3
chr11 215904 rs12226402 SIRT3 UTR3 NM_012239:c.*794C>T SIRT3
chr11 216056 rs12226697 SIRT3 UTR3 NM_012239:c.*642C>T SIRT3
chr11 216290 rs10714 SIRT3 UTR3 NM_012239:c.*408C>T SIRT3
chr11 236337 rs147924046 SIRT3 UTR5 NM_012239:c.-9G>C SIRT3
chr11 236343 rs7118852 SIRT3 UTR5 NM_012239:c.-15T>C SIRT3
chr11 236811 rs519592 PSMD13 UTR5 NM_175932:c.-239G>A PSMD13
chr11 236871 rs2272563 PSMD13 UTR5 NM_175932:c.-179T>C PSMD13
chr10 249600 rs1545003 ZMYND11 UTR3 NM_212479:c.*491A>G ZMYND11
chr11 252649 rs6540 PSMD13 UTR3 NM_175932:c.*49G>A PSMD13
chr11 252733 rs1045405 PSMD13 UTR3 NM_175932:c.*133T>C PSMD13
chr11 252735 rs2948222 PSMD13 UTR3 NM_175932:c.*135T>C PSMD13
chr11 252851 rs6541 PSMD13 UTR3 NM_175932:c.*251A>G PSMD13
chr11 252942 rs1045577 PSMD13 UTR3 NM_175932:c.*342G>A PSMD13
chr10 274239 rs544179610 DIP2C UTR3 NM_014974:c.*3086T>C DIP2C
chr11 295006 rs2242564 PGGHG UTR3 NM_025092:c.*257C>G PGGHG
chr11 295081 rs77726029 PGGHG UTR3 NM_025092:c.*332C>T PGGHG
chr11 295343 rs2242565 PGGHG UTR3 NM_025092:c.*594G>A PGGHG
chr11 295527 rs1060819 PGGHG UTR3 NM_025092:c.*778T>C PGGHG
chr11 295670 rs7104019 PGGHG UTR3 NM_025092:c.*921G>A PGGHG
chr11 298224 rs2293743 IFITM5 UTR3 NM_001025295:c.*277G>A IFITM5
chr11 298316 rs2293744 IFITM5 UTR3 NM_001025295:c.*185G>A IFITM5
chr11 299517 rs113160876 IFITM5 UTR5 NM_001025295:c.-27A>G IFITM5
chr11 308168 rs117941289 IFITM2 UTR5 NM_006435:c.-25G>A IFITM2
chr11 308178 rs1058873 IFITM2 UTR5 NM_006435:c.-15T>C IFITM2
chr11 308180 rs10398 IFITM2 UTR5 NM_006435:c.-13A>G IFITM2
chr11 320836 rs34481144 IFITM3 UTR5 NM_021034:c.-23G>A IFITM3
chr11 381796 rs529841698 B4GALNT4 UTR3 NM_178537:c.*4C>T B4GALNT4
chr12 389102 rs765376964 KDM5A UTR5 NM_001042603:c.-11delC KDM5A
chr12 389102 rs774232890 KDM5A UTR5 NM_001042603:c.-11_-12delCC KDM5A
chr12 389102 rs869172428 KDM5A UTR5 NM_001042603:c.-11_-13delCCC KDM5A
chr12 389102 rs773599992 KDM5A UTR5 NM_001042603:c.-11_-14delCCCC KDM5A
chr12 389102 rs766620209 KDM5A UTR5 NM_001042603:c.-11_-15delCCCCC KDM5A
chr12 389106 rs757934909 KDM5A UTR5 NM_001042603:c.-15C>G KDM5A
chr12 389110 rs775709475 KDM5A UTR5 NM_001042603:c.-19C>T KDM5A
chr11 418179 rs10331 ANO9 UTR3 NM_001347882:c.*192T>G ANO9
chr11 431834 rs55914928 ANO9 UTR5 NM_001347882:c.-34T>C ANO9
chr12 442129 rs4980907 CCDC77 UTR3 NM_001130148:c.*209C>T CCDC77
chr12 442294 rs2302258 CCDC77 UTR3 NM_001130148:c.*374C>T CCDC77
chr12 442384 rs1048466 CCDC77 UTR3 NM_001130148:c.*464G>A CCDC77
chr11 554299 rs10902172 LRRC56 UTR3 NM_198075:c.*23C>G LRRC56
chr12 561505 rs2535408 B4GALNT3 UTR3 NM_173593:c.*54C>T B4GALNT3
chr12 561620 rs182176424 B4GALNT3 UTR3 NM_173593:c.*169G>A B4GALNT3
chr12 561642 rs34798889 B4GALNT3 UTR3 NM_173593:c.*191G>C B4GALNT3
chr12 561727 rs56150479 B4GALNT3 UTR3 NM_173593:c.*276G>A B4GALNT3
chr12 561755 rs769669814 B4GALNT3 UTR3 NM_173593:c.*304G>A B4GALNT3
chr12 561809 rs34979622 B4GALNT3 UTR3 NM_173593:c.*358G>A B4GALNT3
chr12 564538 rs2245910 NINJ2 UTR3 NM_001294346:c.*162A>T NINJ2
chr12 564622 rs2245906 NINJ2 UTR3 NM_001294346:c.*78T>C NINJ2
chr12 663507 rs4980959 NINJ2 UTR5 NM_016533:c.-9G>T NINJ2
chr11 703175 rs7107522 TMEM80 UTR3 NM_174940:c.*25A>G TMEM80
chr11 703807 rs7124408 TMEM80 UTR3 NM_174940:c.*657G>A TMEM80
chr11 704753 rs7941896 TMEM80 UTR3 NM_001276274:c.*107G>A TMEM80
chr11 704792 rs560832770 TMEM80 UTR3 NM_001276274:c.*146A>T TMEM80
chr11 704864 rs11246273 TMEM80 UTR3 NM_001276274:c.*218G>A TMEM80
chr11 704922 rs76837702 TMEM80 UTR3 NM_001276274:c.*276C>T TMEM80
chr11 709401 rs10902202 EPS8L2 UTR5 NM_022772:c.-7A>G EPS8L2
chr11 727216 rs61541872 EPS8L2 UTR3 NM_022772:c.*235C>G EPS8L2
chr11 727310 rs12285459 EPS8L2 UTR3 NM_022772:c.*329T>C EPS8L2
chr11 727359 rs529321822 EPS8L2 UTR3 NM_022772:c.*378T>C EPS8L2
chr11 727452 rs75754018 EPS8L2 UTR3 NM_022772:c.*471C>T EPS8L2
chr11 747445 rs771120190 TALDO1 UTR5 NM_006755:c.-37_-36insCGC TALDO1
chr12 753353 rs372134044 WNK1 UTR5 NM_001184985:c.-213G>T WNK1
chr12 753475 rs3088353 WNK1 UTR5 NM_001184985:c.-91T>G WNK1
chr12 753532 rs537709613 WNK1 UTR5 NM_001184985:c.-34C>T WNK1
chr11 767296 rs192516259 GATD1 UTR3 NM_001318820:c.*3693C>T GATD1
chr11 767400 rs780306725 GATD1 UTR3 NM_001318820:c.*3589C>T GATD1
chr11 767750 rs11606152 GATD1 UTR3 NM_001318820:c.*3239G>A GATD1
chr11 768140 rs74935180 GATD1 UTR3 NM_001318820:c.*2849G>A GATD1
chr11 769241 rs78298413 GATD1 UTR3 NM_001318820:c.*1748C>T GATD1
chr11 769912 rs545139310 GATD1 UTR3 NM_001318820:c.*1077C>T GATD1
chr11 770007 rs7940065 GATD1 UTR3 NM_001318820:c.*982G>A GATD1
chr11 770732 rs77965970 GATD1 UTR3 NM_001318820:c.*257G>C GATD1
chr11 787198 rs553233030 CEND1 UTR3 NM_016564:c.*929C>T CEND1
chr11 787571 rs7483022 CEND1 UTR3 NM_016564:c.*556A>C CEND1
chr11 787679 rs7946354 CEND1 UTR3 NM_016564:c.*448C>A CEND1
chr11 787829 rs71022974 CEND1 UTR3 NM_016564:c.*298delC CEND1
chr11 788007 rs6597982 CEND1 UTR3 NM_016564:c.*120C>T CEND1
chr11 790762 rs17156064 SLC25A22 UTR3 NM_001191060:c.*1153C>T SLC25A22
chr11 791009 rs118051043 SLC25A22 UTR3 NM_001191060:c.*906G>A SLC25A22
chr11 791462 rs4963153 SLC25A22 UTR3 NM_001191060:c.*453C>T SLC25A22
chr11 791898 rs554507285 SLC25A22 UTR3 NM_001191060:c.*17A>C SLC25A22
chr11 795147 rs79919483 SLC25A22 UTR5 NM_001191060:c.-141G>A SLC25A22
chr11 798865 rs12277141 PANO1 UTR3 NM_001293167:c.*592G>C PANO1
chr11 805234 rs7484123 PIDD1 UTR5 NM_145887:c.-846C>T PIDD1
chr10 806945 rs11253451 LARP4B UTR3 NM_015155:c.*5981G>A LARP4B
chr10 807166 rs1057304 LARP4B UTR3 NM_015155:c.*5760A>G LARP4B
chr10 807215 rs1057303 LARP4B UTR3 NM_015155:c.*5711A>G LARP4B
chr10 807734 rs1555897 LARP4B UTR3 NM_015155:c.*5192T>G LARP4B
chr10 807843 rs1555898 LARP4B UTR3 NM_015155:c.*5083A>G LARP4B
chr10 808071 rs7071801 LARP4B UTR3 NM_015155:c.*4855A>G LARP4B
chr10 808268 rs369958781 LARP4B UTR3 NM_015155:c.*4658G>T LARP4B
chr10 808735 rs12774722 LARP4B UTR3 NM_015155:c.*4191C>T LARP4B
chr10 809121 rs2892159 LARP4B UTR3 NM_015155:c.*3805C>T LARP4B
chr10 809440 rs567193044 LARP4B UTR3 NM_015155:c.*3486G>T LARP4B
chr10 809755 rs564982471 LARP4B UTR3 NM_015155:c.*3171C>T LARP4B
chr11 810010 rs866411223 RPLP2 UTR5 NM_001004:c.-225_-217del- RPLP2
chr10 810385 rs10795298 LARP4B UTR3 NM_015155:c.*2541G>C LARP4B
chr10 810978 rs4229 LARP4B UTR3 NM_015155:c.*1948T>A LARP4B
chr10 811346 rs181825779 LARP4B UTR3 NM_015155:c.*1580G>A LARP4B
chr10 812082 rs9124 LARP4B UTR3 NM_015155:c.*844G>A LARP4B
chr10 812454 rs7703 LARP4B UTR3 NM_015155:c.*472G>A LARP4B
chr10 812827 rs533860961 LARP4B UTR3 NM_015155:c.*99A>G LARP4B
chr11 824988 rs778440737 PNPLA2 UTR3 NM_020376:c.*126_*129delTGCA PNPLA2
chr11 825110 rs1138714 PNPLA2 UTR3 NM_020376:c.*248A>G PNPLA2
chr11 831717 rs537835845 CRACR2B UTR3 NM_173584:c.*156C>G CRACR2B
chr11 831809 rs1130276 CRACR2B UTR3 NM_173584:c.*248T>G CRACR2B
chr11 831818 rs34391416 CRACR2B UTR3 NM_173584:c.*257G>A CRACR2B
chr11 832983 rs71022979 CD151 UTR5 NM_004357:c.-3087_-3085del-,NM_139029:c.-3087 CD151
chr11 838419 rs1130678 CD151 UTR3 NM_001039490:c.*227A>G CD151
chr11 838424 rs1130680 CD151 UTR3 NM_001039490:c.*232C>T CD151
chr11 838542 rs1130698 CD151 UTR3 NM_001039490:c.*350C>T CD151
chr11 838634 rs8672 CD151 UTR3 NM_001039490:c.*442C>G CD151
chr11 838672 rs1803956 CD151 UTR3 NM_001039490:c.*480C>T CD151
chr11 838722 rs6762 CD151 UTR3 NM_001039490:c.*530T>C CD151
chr11 838760 rs1130719 CD151 UTR3 NM_001039490:c.*568T>A CD151
chr11 840034 rs11246327 POLR2L UTR3 NM_021128:c.*338G>T POLR2L
chr11 840181 rs35161470 POLR2L UTR3 NM_021128:c.*191G>A POLR2L
chr11 840251 rs11629 POLR2L UTR3 NM_021128:c.*121G>C POLR2L
chr11 840302 rs56118780 POLR2L UTR3 NM_021128:c.*70C>T POLR2L
chr11 840319 rs3059 POLR2L UTR3 NM_021128:c.*53G>A POLR2L
chr11 840363 rs6591 POLR2L UTR3 NM_021128:c.*9G>A POLR2L
chr11 842869 rs533806312 TSPAN4 UTR5 NM_001025238:c.-7436A>C TSPAN4
chr11 866794 rs7091 TSPAN4 UTR3 NM_001025238:c.*164A>G TSPAN4
chr11 866817 rs575392685 TSPAN4 UTR3 NM_001025238:c.*187C>T TSPAN4
chr11 866818 rs182553517 TSPAN4 UTR3 NM_001025238:c.*188G>A TSPAN4
chr11 869158 rs75813514 CHID1 UTR3 NM_001142677:c.*700G>A CHID1
chr11 869280 rs28478730 CHID1 UTR3 NM_001142677:c.*578G>A CHID1
chr12 910778 rs2023944 WNK1 UTR3 NM_001184985:c.*1986G>A WNK1
chr11 910819 rs7950608 CHID1 UTR5 NM_001142677:c.-6003T>C CHID1
chr12 911100 rs1060499 WNK1 UTR3 NM_001184985:c.*2308T>C WNK1
chr12 911993 rs10849584 RAD52 UTR3 NM_001297421:c.*1398G>A RAD52
chr12 912014 rs373924988 RAD52 UTR3 NM_134424:c.*1376_*1377insG,NM_001297421:c.*1 RAD52
chr12 912022 rs56131726 RAD52 UTR3 NM_001297421:c.*1369A>G RAD52
chr12 912391 rs1051672 RAD52 UTR3 NM_001297421:c.*1000C>T RAD52
chr12 912723 rs148165100 RAD52 UTR3 NM_134424:c.*668_*665delTTTT,NM_001297421:c.* RAD52
chr12 912949 rs7310449 RAD52 UTR3 NM_001297421:c.*442C>T RAD52
chr12 913186 rs11571475 RAD52 UTR3 NM_001297421:c.*205T>C RAD52
chr12 913286 rs1051669 RAD52 UTR3 NM_001297421:c.*105G>A RAD52
chr12 913287 rs11571474 RAD52 UTR3 NM_001297421:c.*104C>T RAD52
chr12 916266 rs202015311 RAD52 UTR3 NM_001297422:c.*89C>T RAD52
chr10 931612 rs201543910 LARP4B UTR5 NM_015155:c.-45891delC LARP4B
chr1 944211 rs557955981 NOC2L;SAMD11 UTR3 NM_015658:c.*483T>C NOC2L;SAMD11
chr1 944244 rs371437325 NOC2L;SAMD11 UTR3 NM_015658:c.*450C>T NOC2L;SAMD11
chr1 944296 rs6605067 NOC2L;SAMD11 UTR3 NM_015658:c.*398C>T NOC2L;SAMD11
chr1 944307 rs2839 NOC2L;SAMD11 UTR3 NM_015658:c.*387A>G NOC2L;SAMD11
chr1 944410 rs145942386 NOC2L,SAMD11 UTR3 NM_015658:c.*284_*279delTTCCAG NOC2L,SAMD11
chr1 959241 rs779888371 NOC2L UTR5 NM_015658:c.-1C>T NOC2L
chr1 960684 rs113034360 KLHL17 UTR5 NM_198317:c.-10C>G KLHL17
chr1 965203 rs374466033 KLHL17 UTR3 NM_198317:c.*12C>G KLHL17
chr1 965338 rs374537094 KLHL17 UTR3 NM_198317:c.*147_*150delTTAT KLHL17
chr1 965350 rs3935066 KLHL17 UTR3 NM_198317:c.*159G>A KLHL17
chr1 965592 rs9697711 KLHL17 UTR3 NM_198317:c.*401T>G KLHL17
chr1 965643 rs13303351 KLHL17 UTR3 NM_198317:c.*452T>C KLHL17
chr1 966521 rs146478061 PLEKHN1 UTR5 NM_032129:c.-11C>T PLEKHN1
chr1 974610 rs543878722 PLEKHN1 UTR3 NM_032129:c.*35C>T PLEKHN1
chr1 974797 rs370019776 PLEKHN1 UTR3 NM_032129:c.*222G>T PLEKHN1
chr1 975014 rs28477686 PLEKHN1 UTR3 NM_032129:c.*439C>T PLEKHN1
chr1 975029 rs28536514 PLEKHN1 UTR3 NM_032129:c.*454T>C PLEKHN1
chr1 975058 rs6685581 PLEKHN1 UTR3 NM_032129:c.*483A>G PLEKHN1
chr1 975093 rs28561399 PLEKHN1 UTR3 NM_032129:c.*518G>A PLEKHN1
chr1 975523 rs4970429 PERM1 UTR3 NM_001291366:c.*649A>G PERM1
chr1 975555 rs2340592 PERM1 UTR3 NM_001291366:c.*617C>T PERM1
chr1 975801 rs114918572 PERM1 UTR3 NM_001291366:c.*371C>T PERM1
chr10 988472 rs12772979 GTPBP4 UTR5 NM_012341:c.-8C>T GTPBP4
chr12 991284 rs10849610 ERC1 UTR5 NM_178040:c.-36620T>C ERC1
chr12 991295 rs10849611 ERC1 UTR5 NM_178040:c.-36609A>G ERC1
chr1 1000018 rs146254088 HES4 UTR5 NM_021170:c.-45C>T HES4
chr1 1000079 rs3128113 HES4 UTR5 NM_021170:c.-106T>C HES4
chr1 1000112 rs3121571 HES4 UTR5 NM_021170:c.-139C>A HES4
chr11 1010649 rs72842410 AP2A2 UTR3 NM_001242837:c.*24C>T AP2A2
chr1 1013490 rs4615788 ISG15 UTR5 NM_005101:c.-84C>G ISG15
chr1 1013541 rs15842 ISG15 UTR5 NM_005101:c.-33T>C ISG15
chr10 1017370 rs528445784 GTPBP4 UTR3 NM_012341:c.*143G>A GTPBP4
chr10 1017501 rs2387218 GTPBP4 UTR3 NM_012341:c.*274T>G GTPBP4
chr10 1017507 rs2387219 GTPBP4 UTR3 NM_012341:c.*280A>G GTPBP4
chr10 1019000 rs2170142 IDI2 UTR3 NM_033261:c.*517G>A IDI2
chr10 1019192 rs2127607 IDI2 UTR3 NM_033261:c.*325G>A IDI2
chr10 1019466 rs41260144 IDI2 UTR3 NM_033261:c.*51C>A IDI2
chr12 1027854 rs567169596 ERC1 UTR5 NM_178040:c.-50G>T ERC1
chr10 1048458 rs7089968 IDI1 UTR5 NM_001317957:c.-140C>T IDI1
chr10 1048852 rs755162550 IDI1 UTR5 NM_001317957:c.-534G>T IDI1
chr10 1049130 rs537880796 IDI1 UTR5 NM_004508:c.-127C>T IDI1
chr1 1055000 rs3121561 AGRN UTR3 NM_001305275:c.*19C>T AGRN
chr1 1055037 rs2465136 AGRN UTR3 NM_001305275:c.*56T>C AGRN
chr1 1055137 rs2710872 AGRN UTR3 NM_001305275:c.*156C>T AGRN
chr1 1055393 rs2799072 AGRN UTR3 NM_001305275:c.*412C>T AGRN
chr1 1055426 rs2799073 AGRN UTR3 NM_001305275:c.*445G>A AGRN
chr1 1055604 rs8014 AGRN UTR3 NM_001305275:c.*623G>A AGRN
chr10 1056621 rs7895511 IDI1 UTR5 NM_001317955:c.-12478G>C IDI1
chr1 1074061 rs75479766 RNF223 UTR5 NM_001205252:c.-1495C>T RNF223
chr1 1074098 rs9442367 RNF223 UTR5 NM_001205252:c.-1532C>G RNF223
chr1 1081961 rs1133647 C1orf159 UTR3 NM_017891:c.*932C>A C1orf159
chr1 1082207 rs3766191 C1orf159 UTR3 NM_017891:c.*686G>A C1orf159
chr1 1082764 rs9442395 C1orf159 UTR3 NM_017891:c.*129A>G C1orf159
chr1 1091559 rs112399033 C1orf159 UTR5 NM_017891:c.-16C>T C1orf159
chr1 1116304 rs72892222 C1orf159 UTR5 NM_017891:c.-24761T>G C1orf159
chr10 1129954 rs11250281 WDR37 UTR3 NM_014023:c.*610A>G WDR37
chr10 1129999 rs12359210 WDR37 UTR3 NM_014023:c.*655C>T WDR37
chr10 1131296 rs76312690 WDR37 UTR3 NM_014023:c.*1952C>T WDR37
chr10 1131523 rs565117710 WDR37 UTR3 NM_014023:c.*2179T>C WDR37
chr10 1131684 rs60177282 WDR37 UTR3 NM_014023:c.*2340_*2341delGT WDR37
chr10 1131691 rs77505067 WDR37 UTR3 NM_014023:c.*2347_*2348insGTGC WDR37
chr10 1177802 rs4880783 ADARB2 UTR3 NM_018702:c.*5391C>A ADARB2
chr10 1177861 rs10903397 ADARB2 UTR3 NM_018702:c.*5332T>C ADARB2
chr10 1178150 rs36093407 ADARB2 UTR3 NM_018702:c.*5042_*5043insG ADARB2
chr10 1178156 rs34381966 ADARB2 UTR3 NM_018702:c.*5036_*5037insT ADARB2
chr10 1178396 rs6560716 ADARB2 UTR3 NM_018702:c.*4797A>G ADARB2
chr10 1178489 rs17156036 ADARB2 UTR3 NM_018702:c.*4704A>G ADARB2
chr10 1178519 rs1500966 ADARB2 UTR3 NM_018702:c.*4674G>A ADARB2
chr10 1178641 rs6560717 ADARB2 UTR3 NM_018702:c.*4552C>G ADARB2
chr10 1178659 rs7901513 ADARB2 UTR3 NM_018702:c.*4534A>G ADARB2
chr1 1179200 rs539075182 TTLL10 UTR5 NM_001130045:c.-16G>A TTLL10
chr10 1179459 rs17156046 ADARB2 UTR3 NM_018702:c.*3734G>A ADARB2
chr10 1179535 rs7094153 ADARB2 UTR3 NM_018702:c.*3658G>A ADARB2
chr10 1179817 rs1983027 ADARB2 UTR3 NM_018702:c.*3376T>C ADARB2
chr1 1179830 rs11260546 TTLL10 UTR5 NM_153254:c.-224G>A TTLL10
chr1 1179833 rs11260547 TTLL10 UTR5 NM_153254:c.-221G>T TTLL10
chr10 1180066 rs7081909 ADARB2 UTR3 NM_018702:c.*3127T>C ADARB2
chr10 1180133 rs7097304 ADARB2 UTR3 NM_018702:c.*3060C>G ADARB2
chr10 1180375 rs1983026 ADARB2 UTR3 NM_018702:c.*2818A>G ADARB2
chr10 1180588 rs7082665 ADARB2 UTR3 NM_018702:c.*2605T>C ADARB2
chr10 1180666 rs56179836 ADARB2 UTR3 NM_018702:c.*2526_*2527insCAGAGGG ADARB2
chr10 1180716 rs145840469 ADARB2 UTR3 NM_018702:c.*2477G>A ADARB2
chr10 1180765 rs4880784 ADARB2 UTR3 NM_018702:c.*2428G>A ADARB2
chr10 1180843 rs17293692 ADARB2 UTR3 NM_018702:c.*2350G>A ADARB2
chr10 1181004 rs4880484 ADARB2 UTR3 NM_018702:c.*2189A>G ADARB2
chr10 1181051 rs4880485 ADARB2 UTR3 NM_018702:c.*2142T>C ADARB2
chr10 1181241 rs7914227 ADARB2 UTR3 NM_018702:c.*1952A>G ADARB2
chr10 1181245 rs7914228 ADARB2 UTR3 NM_018702:c.*1948A>T ADARB2
chr10 1181269 rs11431343 ADARB2 UTR3 NM_018702:c.*1923_*1924insA ADARB2
chr10 1181358 rs2280014 ADARB2 UTR3 NM_018702:c.*1835T>G ADARB2
chr10 1181359 rs7894015 ADARB2 UTR3 NM_018702:c.*1834C>T ADARB2
chr10 1181657 rs10794729 ADARB2 UTR3 NM_018702:c.*1536T>C ADARB2
chr10 1181745 rs10903398 ADARB2 UTR3 NM_018702:c.*1448C>T ADARB2
chr10 1181928 rs10903399 ADARB2 UTR3 NM_018702:c.*1265A>G ADARB2
chr10 1181971 rs11250313 ADARB2 UTR3 NM_018702:c.*1222T>C ADARB2
chr10 1182266 rs1046914 ADARB2 UTR3 NM_018702:c.*927A>G ADARB2
chr10 1182356 rs904957 ADARB2 UTR3 NM_018702:c.*837C>T ADARB2
chr10 1182412 rs2016287 ADARB2 UTR3 NM_018702:c.*781G>A ADARB2
chr10 1182683 rs3750679 ADARB2 UTR3 NM_018702:c.*510A>G ADARB2
chr10 1182970 rs904959 ADARB2 UTR3 NM_018702:c.*223T>C ADARB2
chr10 1183069 rs904960 ADARB2 UTR3 NM_018702:c.*124C>T ADARB2
chr10 1183114 rs141081834 ADARB2 UTR3 NM_018702:c.*79G>A ADARB2
chr1 1185156 rs77950429 TTLL10 UTR3 NM_153254:c.*14G>A TTLL10
chr1 1185241 rs74758268 TTLL10 UTR3 NM_153254:c.*99T>C TTLL10
chr1 1185634 rs3813204 TTLL10 UTR3 NM_153254:c.*492G>A TTLL10
chr1 1197867 rs566195204 TTLL10 UTR3 NM_001130045:c.*20G>A TTLL10
chr1 1197874 rs12026794 TTLL10 UTR3 NM_001130045:c.*27G>A TTLL10
chr1 1197893 rs12031928 TTLL10 UTR3 NM_001130045:c.*46T>C TTLL10
chr1 1197932 rs142233803 TTLL10 UTR3 NM_001130045:c.*85_*86delACAAAC TTLL10
chr11 1201051 rs13010 MUC5AC UTR3 NM_001304359:c.*349A>C MUC5AC
chr1 1203533 rs3819001 TNFRSF18 UTR3 NM_148902:c.*311A>G TNFRSF18
chr1 1211405 rs2298209 TNFRSF4 UTR3 NM_003327:c.*150C>G TNFRSF4
chr1 1211473 rs2298210 TNFRSF4 UTR3 NM_003327:c.*82C>T TNFRSF4
chr1 1217221 rs74355107 SDF4 UTR3 NM_016176:c.*291T>C SDF4
chr1 1217351 rs76053780 SDF4 UTR3 NM_016176:c.*161C>T SDF4
chr1 1217384 rs71768002 SDF4 UTR3 NM_016547:c.*286_*281delCGCGGC,NM_016176:c.*1 SDF4
chr1 1233463 rs148754856 B3GALT6 UTR3 NM_080605:c.*195C>T B3GALT6
chr1 1242539 rs3835300 FAM132A UTR3 NM_001014980:c.*9delA FAM132A
chr1 1255143 rs1058161 UBE2J2 UTR3 NM_194458:c.*60G>A UBE2J2
chr11 1261723 rs55962213 MUC5B UTR3 NM_002458:c.*115C>T MUC5B
chr1 1273803 rs3831194 UBE2J2 UTR5 NM_194315:c.-5812_-5811insGCG,NM_058167:c.-58 UBE2J2
chr11 1275007 rs5744034 TOLLIP UTR3 NM_001318512:c.*2032T>C TOLLIP
chr11 1275033 rs5744033 TOLLIP UTR3 NM_001318512:c.*2006C>G TOLLIP
chr11 1275133 rs5744032 TOLLIP UTR3 NM_001318512:c.*1906A>C TOLLIP
chr11 1275419 rs3168046 TOLLIP UTR3 NM_001318512:c.*1620C>T TOLLIP
chr11 1276907 rs41314515 TOLLIP UTR3 NM_001318512:c.*132G>A TOLLIP
chr1 1291864 rs2239609 SCNN1D UTR3 NM_001130413:c.*254G>A SCNN1D
chr1 1291869 rs621668 SCNN1D UTR3 NM_001130413:c.*259T>C SCNN1D
chr1 1292027 rs570351359 SCNN1D UTR3 NM_001130413:c.*417C>T SCNN1D
chr1 1292517 rs3737721 ACAP3 UTR3 NM_030649:c.*1047T>C ACAP3
chr1 1292946 rs72896218 ACAP3 UTR3 NM_030649:c.*618T>A ACAP3
chr1 1293190 rs561599072 ACAP3 UTR3 NM_030649:c.*374C>G ACAP3
chr1 1323147 rs140361978 INTS11 UTR5 NM_001256456:c.-1194G>A INTS11
chr1 1324788 rs61766199 CPTP UTR5 NM_001029885:c.-2123C>A CPTP
chr1 1324816 rs113921856 CPTP UTR5 NM_001029885:c.-2095G>A CPTP
chr1 1327764 rs307350 CPTP UTR3 NM_001029885:c.*1G>A CPTP
chr1 1327982 rs4970433 CPTP UTR3 NM_001029885:c.*219G>A CPTP
chr1 1328077 rs307351 CPTP UTR3 NM_001029885:c.*314T>C CPTP
chr1 1328799 rs754410477 CPTP UTR3 NM_001029885:c.*1036G>A CPTP
chr1 1334508 rs139522421 TAS1R3 UTR3 NM_152228:c.*44C>A TAS1R3
chr1 1334606 rs35424002 TAS1R3 UTR3 NM_152228:c.*142G>A TAS1R3
chr1 1334669 rs113534227 TAS1R3 UTR3 NM_152228:c.*205T>G TAS1R3
chr1 1334752 rs72634803 TAS1R3 UTR3 NM_152228:c.*288G>A TAS1R3
chr1 1334871 rs141342516 TAS1R3 UTR3 NM_152228:c.*407C>T TAS1R3
chr1 1334949 rs188647 TAS1R3 UTR3 NM_152228:c.*485A>G TAS1R3
chr1 1334979 rs307374 TAS1R3 UTR3 NM_152228:c.*515T>C TAS1R3
chr1 1335073 rs11488701 TAS1R3 UTR3 NM_152228:c.*609C>T TAS1R3
chr1 1335102 rs377021118 TAS1R3 UTR3 NM_152228:c.*638T>C TAS1R3
chr1 1335795 rs307373 DVL1 UTR3 NM_004421:c.*347T>C DVL1
chr1 1336133 rs377426716 DVL1 UTR3 NM_004421:c.*9G>T DVL1
chr1 1349110 rs150789461 DVL1 UTR5 NM_004421:c.-45C>T DVL1
chr1 1352965 rs13249 MXRA8 UTR3 NM_032348:c.*639T>C MXRA8
chr1 1353091 rs3766183 MXRA8 UTR3 NM_032348:c.*513G>A MXRA8
chr1 1353148 rs191103566 MXRA8 UTR3 NM_032348:c.*456G>T MXRA8
chr1 1353203 rs3845295 MXRA8 UTR3 NM_032348:c.*401G>C MXRA8
chr1 1353443 rs2296471 MXRA8 UTR3 NM_032348:c.*161T>C MXRA8
chr1 1361311 rs2765025 MXRA8 UTR5 NM_001282583:c.-48G>C MXRA8
chr1 1361438 rs2765024 MXRA8 UTR5 NM_001282583:c.-175G>C MXRA8
chr1 1361461 rs538602808 MXRA8 UTR5 NM_001282583:c.-198C>A MXRA8
chr1 1361679 rs35056373 MXRA8 UTR5 NM_001282583:c.-416C>T MXRA8
chr1 1361685 rs2765023 MXRA8 UTR5 NM_001282583:c.-422G>A MXRA8
chr1 1375288 rs2242398 AURKAIP1 UTR5 NM_017900:c.-532T>G AURKAIP1
chr1 1385919 rs397786933 CCNL2 UTR3 NM_030937:c.*1311_*1312insC CCNL2
chr11 1390271 rs112066837 BRSK2 UTR5 NM_003957:c.-14C>T BRSK2
chr1 1390917 rs570662665 CCNL2 UTR5 NM_001320153:c.-59G>C CCNL2
chr1 1402321 rs192585854 MRPL20 UTR3 NM_001318485:c.*248C>T MRPL20
chr1 1402457 rs1240709 MRPL20 UTR3 NM_001318485:c.*112T>C MRPL20
chr1 1407232 rs2275915 MRPL20 UTR5 NM_017971:c.-15C>G MRPL20
chr11 1410700 rs61867658 BRSK2 UTR5 NM_001282218:c.-25429C>A BRSK2
chr11 1411191 rs61867659 BRSK2 UTR5 NM_001256630:c.-214C>G BRSK2
chr1 1418680 rs143038747 ANKRD65 UTR3 NM_001145210:c.*420C>T ANKRD65
chr1 1421170 rs12089560 ANKRD65 UTR5 NM_001145210:c.-165T>C ANKRD65
chr1 1435695 rs568492558 VWA1 UTR5 NM_022834:c.-54C>G VWA1
chr1 1439805 rs1240699 VWA1 UTR3 NM_022834:c.*18G>C VWA1
chr1 1439827 rs140247431 VWA1 UTR3 NM_022834:c.*40T>C VWA1
chr1 1440430 rs4590 VWA1 UTR3 NM_022834:c.*643C>G VWA1
chr1 1440567 rs13683 VWA1 UTR3 NM_022834:c.*780T>G VWA1
chr1 1440834 rs1240698 VWA1 UTR3 NM_022834:c.*1047C>G VWA1
chr1 1441187 rs1240697 VWA1 UTR3 NM_022834:c.*1400A>G VWA1
chr1 1442155 rs78727284 VWA1 UTR3 NM_022834:c.*2368G>A VWA1
chr1 1442793 rs711180 VWA1 UTR3 NM_022834:c.*3006G>A VWA1
chr1 1449831 rs1312568 ATAD3C UTR5 NM_001039211:c.-853A>G ATAD3C
chr1 1450193 rs1240588 ATAD3C UTR5 NM_001039211:c.-491C>T ATAD3C
chr1 1450323 rs538836491 ATAD3C UTR5 NM_001039211:c.-361_-360del- ATAD3C
chr1 1450612 rs566815034 ATAD3C UTR5 NM_001039211:c.-72T>A ATAD3C
chr1 1450636 rs34301361 ATAD3C UTR5 NM_001039211:c.-48A>G ATAD3C
chr11 1460732 rs756966521 BRSK2 UTR3 NM_001256627:c.*9_*10insC,NM_001256630:c.*9_* BRSK2
chr11 1460733 rs34875491 BRSK2 UTR3 NM_001256627:c.*10delC,NM_001256630:c.*10delC BRSK2
chr11 1460784 rs12291300 BRSK2 UTR3 NM_001256627:c.*61G>A BRSK2
chr11 1461258 rs1574122 BRSK2 UTR3 NM_003957:c.*269T>C BRSK2
chr11 1461352 rs6578412 BRSK2 UTR3 NM_003957:c.*363T>C BRSK2
chr11 1461490 rs4072884 BRSK2 UTR3 NM_003957:c.*501C>T BRSK2
chr11 1461621 rs3829225 BRSK2 UTR3 NM_003957:c.*632T>C BRSK2
chr11 1461887 rs4046908 BRSK2 UTR3 NM_003957:c.*898_*899insTC,NM_001256629:c.*92 BRSK2
chr11 1461947 rs1881505 BRSK2 UTR3 NM_003957:c.*958T>C BRSK2
chr11 1461950 rs118109180 BRSK2 UTR3 NM_003957:c.*961A>G BRSK2
chr11 1462313 rs9795439 BRSK2 UTR3 NM_003957:c.*1324A>G BRSK2
chr1 1468592 rs111566296 ATAD3C UTR3 NM_001039211:c.*62_*63insG ATAD3C
chr1 1468599 rs571274367 ATAD3C UTR3 NM_001039211:c.*69G>A ATAD3C
chr1 1468621 rs149123833 ATAD3C UTR3 NM_001039211:c.*91G>T ATAD3C
chr1 1468636 rs12089719 ATAD3C UTR3 NM_001039211:c.*106G>A ATAD3C
chr1 1468856 rs1240730 ATAD3C UTR3 NM_001039211:c.*326C>T ATAD3C
chr1 1468864 rs550588216 ATAD3C UTR3 NM_001039211:c.*334C>T ATAD3C
chr1 1469429 rs1240732 ATAD3C UTR3 NM_001039211:c.*899A>G ATAD3C
chr1 1469469 rs74572329 ATAD3C UTR3 NM_001039211:c.*939G>C ATAD3C
chr11 1469866 rs9440 MOB2 UTR3 NM_001172223:c.*306C>T MOB2
chr1 1470034 rs1240733 ATAD3C UTR3 NM_001039211:c.*1504T>C ATAD3C
chr11 1470111 rs62623399 MOB2 UTR3 NM_001172223:c.*61G>C MOB2
chr1 1471785 rs140699979 ATAD3B UTR5 NM_031921:c.-100C>T ATAD3B
chr1 1471860 rs749270452 ATAD3B UTR5 NM_031921:c.-25C>T ATAD3B
chr11 1486565 rs1110206 MOB2 UTR5 NM_001172223:c.-9C>T MOB2
chr11 1486568 rs146710160 MOB2 UTR5 NM_001172223:c.-12C>T MOB2
chr11 1486746 rs12798762 MOB2 UTR5 NM_001172223:c.-190A>G MOB2
chr12 1490891 rs117418530 ERC1 UTR3 NM_178040:c.*661C>T ERC1
chr12 1491595 rs398116015 ERC1 UTR3 NM_178039:c.*1365_*1366insG,NM_178040:c.*1365 ERC1
chr12 1491601 rs61912169 ERC1 UTR3 NM_178040:c.*1371T>G ERC1
chr12 1491812 rs1064125 ERC1 UTR3 NM_178040:c.*1582A>T ERC1
chr12 1492395 rs3741977 ERC1 UTR3 NM_178040:c.*2165G>A ERC1
chr12 1492556 rs10773946 ERC1 UTR3 NM_178040:c.*2326C>G ERC1
chr12 1492730 rs3741976 ERC1 UTR3 NM_178040:c.*2500C>T ERC1
chr12 1493436 rs1134345 ERC1 UTR3 NM_178040:c.*3206A>G ERC1
chr12 1493486 rs1134346 ERC1 UTR3 NM_178040:c.*3256G>A ERC1
chr12 1493544 rs201272886 ERC1 UTR3 NM_178040:c.*3314A>T ERC1
chr12 1493546 rs202225801 ERC1 UTR3 NM_178040:c.*3316A>T ERC1
chr12 1493548 rs4765820 ERC1 UTR3 NM_178040:c.*3318A>T ERC1
chr12 1495324 rs1046473 ERC1 UTR3 NM_178040:c.*5094A>C ERC1
chr12 1495350 rs1046475 ERC1 UTR3 NM_178040:c.*5120T>C ERC1
chr12 1495485 rs739971 ERC1 UTR3 NM_178040:c.*5255G>A ERC1
chr1 1495905 rs3842878 ATAD3B UTR3 NM_031921:c.*88T>G ATAD3B
chr1 1496122 rs8241 ATAD3B UTR3 NM_031921:c.*305G>A ATAD3B
chr1 1512558 rs779526741 ATAD3A UTR5 NM_001170536:c.-3486C>T ATAD3A
chr1 1534121 rs141788544 ATAD3A UTR3 NM_001170535:c.*49C>T ATAD3A
chr1 1534166 rs3128344 ATAD3A UTR3 NM_001170535:c.*94G>A ATAD3A
chr1 1534218 rs9439464 ATAD3A UTR3 NM_001170535:c.*146C>G ATAD3A
chr1 1534219 rs3128343 ATAD3A UTR3 NM_001170535:c.*147G>C ATAD3A
chr1 1534226 rs35611435 ATAD3A UTR3 NM_001170535:c.*154C>T ATAD3A
chr1 1534234 rs553545709 ATAD3A UTR3 NM_001170535:c.*162C>T ATAD3A
chr1 1534356 rs3897224 ATAD3A UTR3 NM_001170535:c.*284C>T ATAD3A
chr1 1534402 rs17161064 ATAD3A UTR3 NM_001170535:c.*330G>C ATAD3A
chr1 1534446 rs182747581 ATAD3A UTR3 NM_001170535:c.*374G>A ATAD3A
chr1 1534481 rs116603779 ATAD3A UTR3 NM_001170535:c.*409C>T ATAD3A
chr1 1534909 rs560651927 TMEM240 UTR3 NM_001114748:c.*450C>T TMEM240
chr1 1534915 rs4994703 TMEM240 UTR3 NM_001114748:c.*444A>G TMEM240
chr1 1535017 rs375304946 TMEM240 UTR3 NM_001114748:c.*342C>T TMEM240
chr1 1535018 rs7417423 TMEM240 UTR3 NM_001114748:c.*341G>A TMEM240
chr1 1541728 rs1046878 SSU72 UTR3 NM_014188:c.*338C>T SSU72
chr1 1541864 rs7290 SSU72 UTR3 NM_014188:c.*202A>G SSU72
chr1 1541944 rs397692181 SSU72 UTR3 NM_014188:c.*122_*121delTG SSU72
chr12 1566370 rs11614821 FBXL14 UTR3 NM_152441:c.*378C>A FBXL14
chr12 1566681 rs73030956 FBXL14 UTR3 NM_152441:c.*67C>T FBXL14
chr1 1574656 rs70949599 SSU72 UTR5 NM_014188:c.-99_-100delGC SSU72
chr1 1574828 rs558099134 SSU72 UTR5 NM_014188:c.-271C>T SSU72
chr12 1594156 rs774399331 FBXL14 UTR5 NM_152441:c.-91_-90insGGC FBXL14
chr12 1594157 rs544992054 FBXL14 UTR5 NM_152441:c.-91_-93delGGC FBXL14
chr1 1598099 rs28737320 FNDC10 UTR3 NM_001242659:c.*1236G>C FNDC10
chr1 1599234 rs11552172 FNDC10 UTR3 NM_001242659:c.*101A>G FNDC10
chr1 1599330 rs79079518 FNDC10 UTR3 NM_001242659:c.*5C>G FNDC10
chr1 1615869 rs9726211 MIB2 UTR5 NM_001170689:c.-7584C>T MIB2
chr1 1630592 rs137939848 MIB2 UTR3 NM_080875:c.*62G>C MIB2
chr12 1646488 rs3803164 WNT5B UTR3 NM_030775:c.*236C>T WNT5B
chr1 1657267 rs61774959 CDK11B UTR5 NM_033489:c.-3C>T CDK11B
chr1 1657287 rs61776760 CDK11B UTR5 NM_033489:c.-23G>A CDK11B
chr1 1657293 rs61776761 CDK11B UTR5 NM_033489:c.-29T>A CDK11B
chr1 1657295 rs79724854 CDK11B UTR5 NM_033489:c.-31_-33delCGC CDK11B
chr1 1659015 rs570174521 CDK11B UTR5 NM_001291345:c.-1530C>A CDK11B
chr1 1659060 rs79113395 CDK11B UTR5 NM_001291345:c.-1575C>T CDK11B
chr1 1662907 rs74047817 SLC35E2B UTR3 NM_001110781:c.*2875G>A SLC35E2B
chr1 1662933 rs141732428 SLC35E2B UTR3 NM_001110781:c.*2849A>T SLC35E2B
chr1 1663773 rs370771686 SLC35E2B UTR3 NM_001110781:c.*2009T>C SLC35E2B
chr1 1664099 rs6700227 SLC35E2B UTR3 NM_001110781:c.*1683A>G SLC35E2B
chr1 1665061 rs72634819 SLC35E2B UTR3 NM_001110781:c.*721G>A SLC35E2B
chr1 1665555 rs34272997 SLC35E2B UTR3 NM_001110781:c.*227G>A SLC35E2B
chr1 1665581 rs72634820 SLC35E2B UTR3 NM_001110781:c.*201G>C SLC35E2B
chr1 1676790 rs61776790 SLC35E2B UTR5 NM_001110781:c.-91G>A SLC35E2B
chr1 1691377 rs1855706 SLC35E2B UTR5 NM_001290264:c.-14678G>A SLC35E2B
chr1 1727506 rs1062057 SLC35E2 UTR3 NM_182838:c.*4949A>G SLC35E2
chr1 1728604 rs1546881 SLC35E2 UTR3 NM_182838:c.*3851A>T SLC35E2
chr1 1728671 rs1801781 SLC35E2 UTR3 NM_182838:c.*3784G>T SLC35E2
chr1 1728948 rs2377221 SLC35E2 UTR3 NM_182838:c.*3507A>G SLC35E2
chr1 1728965 rs1801778 SLC35E2 UTR3 NM_182838:c.*3490T>C SLC35E2
chr1 1729196 rs2377220 SLC35E2 UTR3 NM_182838:c.*3259A>C SLC35E2
chr1 1729539 rs1972183 SLC35E2 UTR3 NM_182838:c.*2916G>T SLC35E2
chr1 1730405 rs61777505 SLC35E2 UTR3 NM_182838:c.*2050C>G SLC35E2
chr1 1730876 rs144341301 SLC35E2 UTR3 NM_182838:c.*1579G>C SLC35E2
chr1 1730989 rs2281171 SLC35E2 UTR3 NM_182838:c.*1466T>C SLC35E2
chr1 1731375 rs61777506 SLC35E2 UTR3 NM_182838:c.*1080A>G SLC35E2
chr1 1731456 rs61777507 SLC35E2 UTR3 NM_182838:c.*999T>C SLC35E2
chr1 1731963 rs34298494 SLC35E2 UTR3 NM_182838:c.*492T>G SLC35E2
chr1 1732013 rs35158882 SLC35E2 UTR3 NM_182838:c.*442C>T SLC35E2
chr1 1732166 rs66653340 SLC35E2 UTR3 NM_182838:c.*289T>C SLC35E2
chr1 1732357 rs531609517 SLC35E2 UTR3 NM_182838:c.*98C>G SLC35E2
chr1 1732392 rs3817856 SLC35E2 UTR3 NM_182838:c.*63G>A SLC35E2
chr1 1732412 rs2294486 SLC35E2 UTR3 NM_182838:c.*43C>G SLC35E2
chr1 1732422 rs2294487 SLC35E2 UTR3 NM_182838:c.*33C>T SLC35E2
chr10 1737155 rs3750684 ADARB2 UTR5 NM_018702:c.-5C>T ADARB2
chr10 1737304 rs3750683 ADARB2 UTR5 NM_018702:c.-154A>G ADARB2
chr1 1744652 rs143820282 SLC35E2 UTR5 NM_001199787:c.-5095G>A SLC35E2
chr11 1750552 rs151133972 IFITM10 UTR5 NM_001170820:c.-110C>T IFITM10
chr11 1750567 rs3740621 IFITM10 UTR5 NM_001170820:c.-125A>G IFITM10
chr1 1752461 rs1062090 NADK UTR3 NM_001198995:c.*443C>T NADK
chr1 1752624 rs2235534 NADK UTR3 NM_001198995:c.*280G>A NADK
chr1 1752730 rs7796 NADK UTR3 NM_001198995:c.*174G>C NADK
chr1 1752816 rs544120880 NADK UTR3 NM_001198995:c.*88T>C NADK
chr11 1752906 rs8839 CTSD UTR3 NM_001909:c.*597A>C CTSD
chr11 1753145 rs542969755 CTSD UTR3 NM_001909:c.*358C>T CTSD
chr11 1753386 rs527778631 CTSD UTR3 NM_001909:c.*117C>T CTSD
chr11 1753436 rs12214 CTSD UTR3 NM_001909:c.*67A>G CTSD
chr11 1753492 rs377057633 CTSD UTR3 NM_001909:c.*11G>A CTSD
chr11 1763883 rs587780917 CTSD UTR5 NM_001909:c.-24C>T CTSD
chr12 1786206 rs730032 ADIPOR2 UTR3 NM_024551:c.*134G>A ADIPOR2
chr12 1786207 rs758169 ADIPOR2 UTR3 NM_024551:c.*135T>G ADIPOR2
chr12 1787714 rs12342 ADIPOR2 UTR3 NM_024551:c.*1642C>T ADIPOR2
chr12 1787790 rs1044471 ADIPOR2 UTR3 NM_024551:c.*1718C>T ADIPOR2
chr12 1792226 rs77487055 CACNA2D4 UTR3 NM_172364:c.*1428_*1429insGAG CACNA2D4
chr12 1792268 rs13219 CACNA2D4 UTR3 NM_172364:c.*1387G>A CACNA2D4
chr12 1792319 rs1044825 CACNA2D4 UTR3 NM_172364:c.*1336C>A CACNA2D4
chr12 1792380 rs12811035 CACNA2D4 UTR3 NM_172364:c.*1275T>G CACNA2D4
chr12 1792453 rs796642015 CACNA2D4 UTR3 NM_172364:c.*1202delC CACNA2D4
chr12 1792541 rs567383410 CACNA2D4 UTR3 NM_172364:c.*1114G>A CACNA2D4
chr12 1792998 rs2286379 CACNA2D4 UTR3 NM_172364:c.*657G>A CACNA2D4
chr12 1793600 rs2058111 CACNA2D4 UTR3 NM_172364:c.*55A>C CACNA2D4
chr12 1820792 rs4765845 LRTM2 UTR5 NM_001163925:c.-7357G>A LRTM2
chr12 1827572 rs569171614 LRTM2 UTR5 NM_001163925:c.-577G>A LRTM2
chr11 1834430 rs117301354 SYT8 UTR5 NM_001290333:c.-155C>T SYT8
chr12 1834863 rs769086512 LRTM2 UTR3 NM_001163925:c.*142C>T LRTM2
chr12 1835433 rs78537235 LRTM2 UTR3 NM_001163925:c.*712A>G LRTM2
chr12 1836333 rs11061996 LRTM2 UTR3 NM_001163925:c.*1612G>A LRTM2
chr12 1836411 rs75024051 LRTM2 UTR3 NM_001163925:c.*1690G>A LRTM2
chr11 1841626 rs555004172 TNNI2 UTR3 NM_003282:c.*75T>C TNNI2
chr11 1852991 rs907612 LSP1 UTR5 NM_002339:c.-154C>T LSP1
chr11 1853016 rs200294238 LSP1 UTR5 NM_002339:c.-129C>T LSP1
chr11 1853036 rs2089909 LSP1 UTR5 NM_002339:c.-109C>T LSP1
chr11 1853062 rs907613 LSP1 UTR5 NM_002339:c.-83G>A LSP1
chr11 1870492 rs686722 LSP1 UTR5 NM_001289005:c.-9728C>T LSP1
chr11 1870656 rs35241556 LSP1 UTR5 NM_001289005:c.-9564G>A LSP1
chr11 1871355 rs4980389 LSP1 UTR5 NM_001013254:c.-8865G>A LSP1
chr11 1892147 rs548195 LSP1 UTR3 NM_002339:c.*388A>G LSP1
chr1 1914918 rs2748988 CALML6 UTR5 NM_001330313:c.-363G>A CALML6
chr1 1915022 rs41306992 CALML6 UTR5 NM_001330313:c.-259C>T CALML6
chr1 1915143 rs2748987 CALML6 UTR5 NM_001330313:c.-138A>G CALML6
chr12 1918564 rs76066543 CACNA2D4 UTR5 NM_172364:c.-91G>A CACNA2D4
chr1 1919276 rs751295993 TMEM52 UTR5 NM_178545:c.-11C>T TMEM52
chr11 1921454 rs74047681 TNNT3 UTR5 NM_001297646:c.-1421A>T TNNT3
chr11 1921456 rs74047682 TNNT3 UTR5 NM_001297646:c.-1419C>T TNNT3
chr1 1921955 rs2144687 CFAP74 UTR3 NM_001304360:c.*332A>G CFAP74
chr1 1921970 rs555440917 CFAP74 UTR3 NM_001304360:c.*317T>G CFAP74
chr1 1922149 rs2144686 CFAP74 UTR3 NM_001304360:c.*138G>A CFAP74
chr1 1922176 rs3039777 CFAP74 UTR3 NM_001304360:c.*110_*111insTCAG CFAP74
chr11 1938578 rs200540491 TNNT3 UTR3 NM_001042782:c.*86C>T TNNT3
chr12 1946100 rs7222 DCP1B UTR3 NM_152640:c.*106A>G DCP1B
chr12 1946104 rs568188276 DCP1B UTR3 NM_152640:c.*102A>T DCP1B
chr12 1946198 rs749725232 DCP1B UTR3 NM_152640:c.*8G>C DCP1B
chr12 1992992 rs148288647 DCP1B UTR3 NM_001319292:c.*129T>C DCP1B
chr12 1993105 rs112637373 DCP1B UTR3 NM_001319292:c.*16A>C DCP1B
chr11 1994605 rs217728 HOTS UTR5 NM_001293171:c.-592C>T HOTS
chr12 2053407 rs556115197 CACNA1C UTR5 NM_001167623:c.-156C>T CACNA1C
chr1 2073508 rs2678942 PRKCZ UTR5 NM_001033581:c.-70831T>C PRKCZ
chr1 2074125 rs556583628 PRKCZ UTR5 NM_001242874:c.-129C>T PRKCZ
chr1 2104824 rs10797413 PRKCZ UTR5 NM_001033582:c.-39515G>A PRKCZ
chr11 2129214 rs2585 IGF2 UTR3 NM_001127598:c.*3773A>G IGF2
chr11 2131311 rs3168310 IGF2 UTR3 NM_001127598:c.*1676G>C IGF2
chr11 2131568 rs796234954 IGF2 UTR3 NM_000612:c.*1419_*1418delCA,NM_001127598:c.* IGF2
chr11 2131611 rs796096545 IGF2 UTR3 NM_000612:c.*1376_*1375delCA,NM_001127598:c.* IGF2
chr11 2132404 rs680 IGF2 UTR3 NM_001127598:c.*583A>G IGF2
chr11 2132958 rs2230949 IGF2 UTR3 NM_001127598:c.*29C>T IGF2
chr11 2132961 rs3741214 IGF2 UTR3 NM_001127598:c.*26C>T IGF2
chr11 2149388 rs748524132 IGF2 UTR5 NM_001007139:c.-13865C>T IGF2
chr11 2149543 rs10743144 IGF2 UTR5 NM_001007139:c.-14020A>G IGF2
chr11 2159830 rs3842753 INS UTR3 NM_001291897:c.*22A>C INS
chr11 2159843 rs3842752 INS UTR3 NM_001291897:c.*9C>T INS
chr11 2160980 rs5505 INS;INS-IGF2 UTR5 NM_001291897:c.-9C>T INS;INS-IGF2
chr11 2160994 rs689 INS UTR5 NM_001185098:c.-23T>A INS
chr11 2161130 rs3842741 INS UTR5 NM_001291897:c.-159A>G INS
chr1 2184752 rs377706761 FAAP20 UTR3 NM_001256945:c.*526T>C FAAP20
chr1 2184848 rs45459595 FAAP20 UTR3 NM_001256945:c.*430G>A FAAP20
chr1 2185016 rs80119748 FAAP20;PRKCZ UTR3 NM_001256945:c.*262C>G FAAP20;PRKCZ
chr1 2186900 rs262685 FAAP20 UTR5 NM_001282671:c.-689T>C FAAP20
chr1 2186920 rs262684 FAAP20 UTR5 NM_001282671:c.-709T>C FAAP20
chr1 2187054 rs573010466 FAAP20 UTR5 NM_001282671:c.-843C>T FAAP20
chr1 2187100 rs2503699 FAAP20 UTR5 NM_001282671:c.-889A>G FAAP20
chr1 2189599 rs544754432 C1orf86 UTR3 NM_182533:c.*110_*83delCAGCAGCCCCGCCTCTCGGCTC C1orf86
chr1 2189679 rs2503701 FAAP20 UTR3 NM_001282670:c.*30G>A FAAP20
chr1 2212668 rs2503715 FAAP20 UTR5 NM_001282670:c.-13680T>C FAAP20
chr11 2268966 rs2072072 ASCL2 UTR3 NM_005170:c.*179G>C ASCL2
chr11 2270485 rs7126721 ASCL2 UTR5 NM_005170:c.-153C>A ASCL2
chr11 2270752 rs968528 ASCL2 UTR5 NM_005170:c.-420A>T ASCL2
chr11 2270850 rs55930300 ASCL2 UTR5 NM_005170:c.-518C>T ASCL2
chr11 2296266 rs80058569 C11orf21 UTR3 NM_001142946:c.*1684G>C C11orf21
chr11 2296684 rs2651837 C11orf21 UTR3 NM_001142946:c.*1266C>T C11orf21
chr11 2296721 rs12800998 C11orf21 UTR3 NM_001142946:c.*1229G>A C11orf21
chr11 2297394 rs74048205 C11orf21 UTR3 NM_001142946:c.*556C>T C11orf21
chr11 2297734 rs61873115 C11orf21 UTR3 NM_001142946:c.*216C>G C11orf21
chr11 2302061 rs375443053 TSPAN32 UTR5 NM_139022:c.-89G>T TSPAN32
chr1 2306798 rs2230008 SKI UTR3 NM_003036:c.*33A>T SKI
chr1 2308567 rs2173049 SKI UTR3 NM_003036:c.*1802T>C SKI
chr1 2308712 rs577964541 SKI UTR3 NM_003036:c.*1947A>G SKI
chr1 2308944 rs2843157 SKI UTR3 NM_003036:c.*2179C>T SKI
chr1 2309937 rs35148324 SKI UTR3 NM_003036:c.*3172_*3173insT SKI
chr1 2309937 rs35148324 SKI UTR3 NM_003036:c.*3172_*3173insTT SKI
chr1 2309996 rs562390109 SKI UTR3 NM_003036:c.*3231C>A SKI
chr1 2321320 rs35513983 MORN1 UTR3 NM_024848:c.*63T>C MORN1
chr1 2391557 rs138323215 MORN1 UTR5 NM_024848:c.-24G>T MORN1
chr1 2391602 rs77804600 MORN1 UTR5 NM_024848:c.-69A>G MORN1
chr11 2396963 rs1063316 CD81 UTR3 NM_001297649:c.*97C>T CD81
chr11 2397107 rs1049390 CD81 UTR3 NM_001297649:c.*241A>G CD81
chr11 2397200 rs1049549 CD81 UTR3 NM_001297649:c.*334T>C CD81
chr11 2397328 rs1049652 CD81 UTR3 NM_001297649:c.*462C>T CD81
chr11 2397332 rs1049659 CD81 UTR3 NM_001297649:c.*466G>A CD81
chr11 2401424 rs562843979 TSSC4 UTR5 NM_001297659:c.-1210C>G TSSC4
chr11 2402315 rs11555995 TSSC4 UTR5 NM_001297658:c.-319A>G TSSC4
chr1 2403284 rs76184090 RER1 UTR3 NM_007033:c.*160G>A RER1
chr1 2403372 rs538017546 RER1 UTR3 NM_007033:c.*248C>T RER1
chr1 2404237 rs1129333 RER1 UTR3 NM_007033:c.*1113A>G RER1
chr1 2404530 rs12085089 RER1 UTR3 NM_007033:c.*1406C>G RER1
chr1 2404771 rs1129332 RER1 UTR3 NM_007033:c.*1647C>T RER1
chr11 2404824 rs562806466 TRPM5 UTR3 NM_014555:c.*113A>T TRPM5
chr1 2405593 rs1129171 PEX10 UTR3 NM_002617:c.*173G>A PEX10
chr1 2405727 rs372022952 PEX10 UTR3 NM_002617:c.*39C>T PEX10
chr1 2405755 rs3795270 PEX10 UTR3 NM_002617:c.*11G>A PEX10
chr12 2691483 rs11062319 CACNA1C UTR3 NM_001167623:c.*284C>T CACNA1C
chr12 2692303 rs11429670 CACNA1C UTR3 NM_001129844:c.*1104_*1105insT,NM_001129829:c CACNA1C
chr12 2694056 rs574512387 CACNA1C UTR3 NM_001167623:c.*2857G>A CACNA1C
chr12 2695472 rs7302540 CACNA1C UTR3 NM_001167623:c.*4273A>G CACNA1C
chr12 2696030 rs4765975 CACNA1C UTR3 NM_001167623:c.*4831T>A CACNA1C
chr12 2697169 rs4765976 CACNA1C UTR3 NM_001167623:c.*5970A>C CACNA1C
chr12 2804062 rs35667665 FKBP4 UTR3 NM_002014:c.*804_*805insC FKBP4
chr12 2826045 rs576458906 NRIP2 UTR3 NM_031474:c.*1162A>G NRIP2
chr12 2826563 rs3056874 NRIP2 UTR3 NM_031474:c.*643_*644insTT NRIP2
chr12 2826883 rs3814250 NRIP2 UTR3 NM_031474:c.*324G>A NRIP2
chr12 2827110 rs3814249 NRIP2 UTR3 NM_031474:c.*97T>C NRIP2
chr12 2885339 rs73040528 RHNO1 UTR5 NM_001252500:c.-28T>C RHNO1
chr12 2885352 rs187710658 RHNO1 UTR5 NM_001252500:c.-15C>G RHNO1
chr11 2887426 rs11024437 SLC22A18AS UTR3 NM_001302862:c.*754C>T SLC22A18AS
chr12 2888490 rs376902913 RHNO1 UTR3 NM_001252500:c.*31T>C RHNO1
chr11 2902537 rs366696 SLC22A18 UTR5 NM_001315501:c.-59A>G SLC22A18
chr11 2903626 rs534134502 SLC22A18AS UTR5 NM_001302862:c.-14994G>C SLC22A18AS
chr12 2939589 rs11062424 TULP3 UTR3 NM_003324:c.*145A>G TULP3
chr12 2939613 rs183726561 TULP3 UTR3 NM_003324:c.*169G>A TULP3
chr12 2940228 rs777643586 TULP3 UTR3 NM_003324:c.*784A>T TULP3
chr12 2940240 rs186749489 TULP3 UTR3 NM_003324:c.*796C>T TULP3
chr12 2940322 rs566548845 TULP3 UTR3 NM_003324:c.*878delA TULP3
chr12 2940322 rs869300730 TULP3 UTR3 NM_003324:c.*878_*879delAA TULP3
chr12 2940358 rs370061445 TULP3 UTR3 NM_003324:c.*914G>A TULP3
chr12 2940359 rs373274187 TULP3 UTR3 NM_003324:c.*915G>A TULP3
chr12 2940465 rs2302282 TULP3 UTR3 NM_003324:c.*1021C>T TULP3
chr12 2940772 rs1047341 TULP3 UTR3 NM_001160408:c.*46C>T TULP3
chr1 3022845 rs12564513 ACTRT2 UTR3 NM_080431:c.*25G>T ACTRT2
chr10 3067525 rs564196901 PFKP UTR5 NM_001323069:c.-36307A>G PFKP
chr10 3069238 rs142632123 PFKP UTR5 NM_001345944:c.-13152A>G PFKP
chr12 3077388 rs376243638 TSPAN9 UTR5 NM_006675:c.-123806_-123804del-,NM_001168320: TSPAN9
chr11 3087276 rs8813 OSBPL5 UTR3 NM_020896:c.*929C>T OSBPL5
chr11 3087800 rs71035475 OSBPL5 UTR3 NM_001144063:c.*404_*405insAGCCAGGGAGC,NM_145 OSBPL5
chr11 3088049 rs11553374 OSBPL5 UTR3 NM_020896:c.*156C>T OSBPL5
chr11 3088054 rs397797486 OSBPL5 UTR3 NM_001144063:c.*150_*151insG,NM_145638:c.*150 OSBPL5
chr11 3088067 rs935431 OSBPL5 UTR3 NM_020896:c.*138C>T OSBPL5
chr11 3088173 rs2289999 OSBPL5 UTR3 NM_020896:c.*32T>C OSBPL5
chr11 3088178 rs2289998 OSBPL5 UTR3 NM_020896:c.*27G>A OSBPL5
chr11 3088196 rs10160757 OSBPL5 UTR3 NM_020896:c.*9A>G OSBPL5
chr10 3104818 rs4269839 PFKP UTR5 NM_001323074:c.-325G>T PFKP
chr10 3104904 rs4424569 PFKP UTR5 NM_001323074:c.-239C>G PFKP
chr10 3104907 rs4469783 PFKP UTR5 NM_001323074:c.-236G>A PFKP
chr10 3105000 rs4256893 PFKP UTR5 NM_001323074:c.-143G>A PFKP
chr10 3105087 rs547181615 PFKP UTR5 NM_001323074:c.-56T>G PFKP
chr10 3105090 rs200145075 PFKP UTR5 NM_001323074:c.-53G>A PFKP
chr11 3129161 rs2277300 OSBPL5 UTR5 NM_020896:c.-13G>A OSBPL5
chr10 3136612 rs3816704 PFKP UTR3 NM_001323069:c.*33G>A PFKP
chr10 3136622 rs1052929 PFKP UTR3 NM_001323069:c.*43T>A PFKP
chr10 3136623 rs9063 PFKP UTR3 NM_001323069:c.*44G>C PFKP
chr10 3136673 rs543 PFKP UTR3 NM_001323069:c.*94G>A PFKP
chr10 3136689 rs1053000 PFKP UTR3 NM_001323069:c.*110C>T PFKP
chr10 3136713 rs7673 PFKP UTR3 NM_001323069:c.*134T>A PFKP
chr10 3136716 rs542 PFKP UTR3 NM_001323069:c.*137T>C PFKP
chr10 3136723 rs541 PFKP UTR3 NM_001323069:c.*144C>T PFKP
chr10 3136794 rs3816712 PFKP UTR3 NM_001323069:c.*215T>C PFKP
chr10 3136795 rs2388564 PFKP UTR3 NM_001323069:c.*216G>A PFKP
chr10 3137776 rs9129 PITRM1 UTR3 NM_014889:c.*255C>G PITRM1
chr10 3137983 rs12678 PITRM1 UTR3 NM_014889:c.*48G>A PITRM1
chr10 3172324 rs4881118 PITRM1 UTR5 NM_001347729:c.-111T>C PITRM1
chr10 3172499 rs117733067 PITRM1 UTR5 NM_001347729:c.-286C>T PITRM1
chr10 3172501 rs55634178 PITRM1 UTR5 NM_001347729:c.-288C>T PITRM1
chr10 3172547 rs7098000 PITRM1 UTR5 NM_001347729:c.-334C>T PITRM1
chr10 3172662 rs74729011 PITRM1 UTR5 NM_001347729:c.-449C>G PITRM1
chr10 3172797 rs771918313 PITRM1 UTR5 NM_014889:c.-25G>T PITRM1
chr10 3172804 rs796665475 PITRM1 UTR5 NM_001242307:c.-32delG,NM_014889:c.-32delG,NM PITRM1
chr11 3227840 rs577639188 MRGPRE UTR3 NM_001039165:c.*21A>G MRGPRE
chr11 3227851 rs11026035 MRGPRE UTR3 NM_001039165:c.*10C>G MRGPRE
chr12 3283185 rs632887 TSPAN9 UTR3 NM_006675:c.*69A>G TSPAN9
chr12 3283392 rs634076 TSPAN9 UTR3 NM_006675:c.*276C>T TSPAN9
chr12 3284253 rs12827449 TSPAN9 UTR3 NM_006675:c.*1137C>T TSPAN9
chr12 3284337 rs6489451 TSPAN9 UTR3 NM_006675:c.*1221G>A TSPAN9
chr12 3284569 rs71577831 TSPAN9 UTR3 NM_006675:c.*1453G>A TSPAN9
chr12 3284932 rs537938 TSPAN9 UTR3 NM_006675:c.*1816T>C TSPAN9
chr12 3286127 rs555561913 TSPAN9 UTR3 NM_006675:c.*3011A>T TSPAN9
chr12 3286294 rs6869 TSPAN9 UTR3 NM_006675:c.*3178T>G TSPAN9
chr11 3358038 rs7101832 ZNF195 UTR3 NM_001256825:c.*1080G>A ZNF195
chr11 3358038 rs7101832 ZNF195 UTR3 NM_001256825:c.*1080G>C ZNF195
chr11 3358087 rs11026713 ZNF195 UTR3 NM_001256825:c.*1031A>C ZNF195
chr11 3358189 rs11026714 ZNF195 UTR3 NM_001256825:c.*929G>C ZNF195
chr11 3358248 rs2106208 ZNF195 UTR3 NM_001256825:c.*870T>C ZNF195
chr11 3358765 rs55873719 ZNF195 UTR3 NM_001256825:c.*352_*353insAATCCAATTTAAGTAAAC ZNF195
chr11 3358778 rs71750598 ZNF195 UTR3 NM_001256825:c.*340delG,NM_001242843:c.*340de ZNF195
chr11 3373664 rs10833820 ZNF195 UTR5 NM_001256825:c.-73C>T ZNF195
chr11 3379104 rs7931660 ZNF195 UTR5 NM_001256825:c.-5513T>C ZNF195
chr11 3379192 rs6578342 ZNF195 UTR5 NM_001256825:c.-5601G>A ZNF195
chr12 3381380 rs9804924 PRMT8 UTR5 NM_001256536:c.-15T>C PRMT8
chr1 3433845 rs3748837 PRDM16 UTR3 NM_022114:c.*34G>A PRDM16
chr1 3433861 rs2493270 PRDM16 UTR3 NM_022114:c.*50A>G PRDM16
chr1 3435445 rs12037306 PRDM16 UTR3 NM_022114:c.*1634G>A PRDM16
chr1 3435663 rs1537406 PRDM16 UTR3 NM_022114:c.*1852T>C PRDM16
chr1 3435783 rs1537405 PRDM16 UTR3 NM_022114:c.*1972T>C PRDM16
chr1 3435939 rs1537404 PRDM16 UTR3 NM_022114:c.*2128G>C PRDM16
chr1 3435977 rs1065247 PRDM16 UTR3 NM_022114:c.*2166T>C PRDM16
chr1 3436015 rs1537402 PRDM16 UTR3 NM_022114:c.*2204T>C PRDM16
chr1 3436200 rs796233383 PRDM16 UTR3 NM_022114:c.*2389delT,NM_199454:c.*2389delT PRDM16
chr1 3436220 rs2493267 PRDM16 UTR3 NM_022114:c.*2409A>G PRDM16
chr1 3436308 rs2236518 PRDM16 UTR3 NM_022114:c.*2497A>C PRDM16
chr1 3437073 rs35837267 PRDM16 UTR3 NM_022114:c.*3262G>A PRDM16
chr1 3437186 rs12728419 PRDM16 UTR3 NM_022114:c.*3375C>T PRDM16
chr1 3437281 rs56113941 PRDM16 UTR3 NM_022114:c.*3470G>A PRDM16
chr1 3437326 rs2493265 PRDM16 UTR3 NM_022114:c.*3515A>G PRDM16
chr1 3437331 rs551745848 PRDM16 UTR3 NM_022114:c.*3520C>T PRDM16
chr1 3437385 rs2493264 PRDM16 UTR3 NM_022114:c.*3574A>G PRDM16
chr1 3438031 rs2483249 PRDM16 UTR3 NM_022114:c.*4220T>C PRDM16
chr1 3438051 rs2493263 PRDM16 UTR3 NM_022114:c.*4240T>C PRDM16
chr1 3480610 rs540632352 ARHGEF16 UTR3 NM_014448:c.*23C>T ARHGEF16
chr1 3480624 rs2487677 ARHGEF16 UTR3 NM_014448:c.*37T>C ARHGEF16
chr1 3480851 rs56102150 ARHGEF16 UTR3 NM_014448:c.*264_*265insCT ARHGEF16
chr1 3480891 rs1051515 ARHGEF16 UTR3 NM_014448:c.*304G>A ARHGEF16
chr1 3481000 rs1051517 ARHGEF16 UTR3 NM_014448:c.*413C>T ARHGEF16
chr1 3488146 rs4648389 MEGF6 UTR3 NM_001409:c.*2382T>C MEGF6
chr1 3490227 rs2821040 MEGF6 UTR3 NM_001409:c.*301T>C MEGF6
chr1 3490360 rs539233794 MEGF6 UTR3 NM_001409:c.*168C>T MEGF6
chr1 3490443 rs2821039 MEGF6 UTR3 NM_001409:c.*85C>T MEGF6
chr1 3490479 rs2794321 MEGF6 UTR3 NM_001409:c.*49C>A MEGF6
chr1 3490503 rs559122601 MEGF6 UTR3 NM_001409:c.*25C>T MEGF6
chr12 3593259 rs146228449 PRMT8 UTR3 NM_001256536:c.*77G>C PRMT8
chr1 3611380 rs10797402 MEGF6 UTR5 NM_001409:c.-112G>C MEGF6
chr1 3628612 rs58849058 TPRG1L UTR3 NM_182752:c.*9_*27delTTCTGGGAGCTCCTCCCCC TPRG1L
chr1 3628686 rs3795257 TPRG1L UTR3 NM_182752:c.*83T>G TPRG1L
chr1 3629048 rs1128474 TPRG1L UTR3 NM_182752:c.*445A>G TPRG1L
chr1 3629562 rs71813640 TPRG1L UTR3 NM_182752:c.*959_*962delCAAA TPRG1L
chr1 3629701 rs748470496 TPRG1L UTR3 NM_182752:c.*1098_*1101delCGGG TPRG1L
chr11 3641901 rs7933740 ART5 UTR5 NM_001297668:c.-39C>T ART5
chr11 3641940 rs7111519 ART5 UTR5 NM_001297668:c.-78C>G ART5
chr11 3641971 rs7128137 ART5 UTR5 NM_001297668:c.-109T>C ART5
chr11 3641991 rs35896220 ART5 UTR5 NM_053017:c.-129delA,NM_001297668:c.-129delA ART5
chr11 3641992 rs11500164 ART5 UTR5 NM_001297668:c.-130A>T ART5
chr11 3641994 rs115012337 ART5 UTR5 NM_001297668:c.-132C>T ART5
chr11 3642043 rs7112533 ART5 UTR5 NM_001297668:c.-181G>A ART5
chr11 3642179 rs1567921 ART5 UTR5 NM_001297668:c.-317A>G ART5
chr11 3642192 rs3813888 ART5 UTR5 NM_001297668:c.-330T>C ART5
chr12 3648101 rs10848899 CRACR2A UTR3 NM_032680:c.*371C>T CRACR2A
chr12 3648222 rs11062752 CRACR2A UTR3 NM_032680:c.*250C>G CRACR2A
chr12 3648258 rs877554 CRACR2A UTR3 NM_032680:c.*214T>A CRACR2A
chr12 3648355 rs71534261 CRACR2A UTR3 NM_032680:c.*117G>A CRACR2A
chr12 3648382 rs887304 CRACR2A UTR3 NM_032680:c.*90A>G CRACR2A
chr1 3650062 rs145464993 WRAP73 UTR5 NM_017818:c.-63_-70delCAGCCTGC WRAP73
chr1 3650065 rs561941921 WRAP73 UTR5 NM_017818:c.-66C>G WRAP73
chr1 3650067 rs375432272 WRAP73 UTR5 NM_017818:c.-68G>T WRAP73
chr11 3664213 rs2271582 ART1 UTR3 NM_004314:c.*24G>A ART1
chr11 3664245 rs566327340 ART1 UTR3 NM_004314:c.*56G>A ART1
chr11 3675203 rs572661386 NUP98 UTR3 NM_139132:c.*956G>C NUP98
chr1 3682336 rs2273953 TP73 UTR5 NM_001204186:c.-30G>A TP73
chr1 3682346 rs1801173 TP73 UTR5 NM_001204186:c.-20C>T TP73
chr1 3690790 rs554601812 TP73 UTR5 NM_001126241:c.-116C>T TP73
chr11 3711568 rs112510725 NUP98 UTR3 NM_005387:c.*975G>A NUP98
chr11 3711730 rs658731 NUP98 UTR3 NM_005387:c.*813G>T NUP98
chr12 3733023 rs10491974 CRACR2A UTR5 NM_001144958:c.-36024G>A CRACR2A
chr1 3733087 rs542407265 TP73 UTR3 NM_001204186:c.*325G>A TP73
chr1 3733230 rs9659687 TP73 UTR3 NM_001204186:c.*468A>C TP73
chr1 3733241 rs9659688 TP73 UTR3 NM_001204186:c.*479A>G TP73
chr1 3733753 rs74489056 TP73 UTR3 NM_001204186:c.*991C>A TP73
chr1 3734534 rs1181869 TP73 UTR3 NM_001204186:c.*1772C>T TP73
chr1 3734562 rs1181868 TP73 UTR3 NM_001204186:c.*1800G>T TP73
chr1 3734754 rs1181867 TP73 UTR3 NM_001204186:c.*1992A>G TP73
chr1 3735728 rs562927626 TP73 UTR3 NM_001204186:c.*2966G>A TP73
chr10 3776305 rs2129439 KLF6 UTR3 NM_001300:c.*3234G>A KLF6
chr10 3777522 rs1043009 KLF6 UTR3 NM_001300:c.*2017G>A KLF6
chr10 3777921 rs200387079 KLF6 UTR3 NM_001300:c.*1617_*1618insAA,NM_001160125:c.* KLF6
chr10 3778595 rs1043003 KLF6 UTR3 NM_001300:c.*944A>G KLF6
chr10 3779135 rs7634 KLF6 UTR3 NM_001300:c.*404T>A KLF6
chr10 3779300 rs758787754 KLF6 UTR3 NM_001300:c.*239C>T KLF6
chr10 3779369 rs17731 KLF6 UTR3 NM_001300:c.*170C>T KLF6
chr10 3779435 rs114266304 KLF6 UTR3 NM_001300:c.*104T>C KLF6
chr1 3780326 rs8379 LRRC47 UTR3 NM_020710:c.*762T>G LRRC47
chr1 3780727 rs2996428 LRRC47 UTR3 NM_020710:c.*361G>A LRRC47
chr1 3780782 rs372544368 LRRC47 UTR3 NM_020710:c.*306G>A LRRC47
chr1 3780974 rs71580225 LRRC47 UTR3 NM_020710:c.*113_*114insT LRRC47
chr10 3785018 rs11544694 KLF6 UTR5 NM_001300:c.-4C>A KLF6
chr11 3808540 rs552937750 PGAP2 UTR5 NM_001256240:c.-2720G>T PGAP2
chr12 3809134 rs758799 PARP11 UTR3 NM_001286521:c.*2989C>A PARP11
chr12 3809309 rs700481 PARP11 UTR3 NM_001286521:c.*2814C>T PARP11
chr12 3809355 rs3079895 PARP11 UTR3 NM_001286522:c.*2768_*2767delTT,NM_001286521: PARP11
chr12 3809556 rs71061134 PARP11 UTR3 NM_001286522:c.*2566_*2567insA,NM_001286521:c PARP11
chr12 3809706 rs1860617 PARP11 UTR3 NM_001286521:c.*2417G>T PARP11
chr12 3810503 rs12424076 PARP11 UTR3 NM_001286521:c.*1620A>G PARP11
chr1 3812605 rs7528951 CEP104 UTR3 NM_014704:c.*2797G>C CEP104
chr1 3813023 rs7543169 CEP104 UTR3 NM_014704:c.*2379T>C CEP104
chr1 3813073 rs78103829 CEP104 UTR3 NM_014704:c.*2329A>G CEP104
chr1 3813254 rs566465862 CEP104 UTR3 NM_014704:c.*2147_*2148insA CEP104
chr1 3813267 rs375134656 CEP104 UTR3 NM_014704:c.*2134_*2135insG CEP104
chr1 3813576 rs36097837 CEP104 UTR3 NM_014704:c.*1826G>A CEP104
chr1 3813871 rs6695834 CEP104 UTR3 NM_014704:c.*1531A>G CEP104
chr1 3815053 rs3795255 CEP104 UTR3 NM_014704:c.*349C>G CEP104
chr1 3815090 rs3838969 CEP104 UTR3 NM_014704:c.*311_*312insA CEP104
chr1 3815093 rs34060840 CEP104 UTR3 NM_014704:c.*309G>A CEP104
chr1 3815395 rs12729542 CEP104 UTR3 NM_014704:c.*7G>A CEP104
chr1 3815401 rs12728401 CEP104 UTR3 NM_014704:c.*1C>T CEP104
chr11 3825623 rs398054917 PGAP2 UTR3 NM_001256235:c.*165_*167delCTC,NM_001283040:c PGAP2
chr11 3826031 rs1055639 PGAP2 UTR3 NM_001256235:c.*573C>T PGAP2
chr11 3826063 rs1055640 PGAP2 UTR3 NM_001256235:c.*605A>G PGAP2
chr11 3827143 rs1049388 RHOG UTR3 NM_001665:c.*420C>G RHOG
chr11 3827421 rs541211871 RHOG UTR3 NM_001665:c.*142C>T RHOG
chr11 3855844 rs10835206 STIM1 UTR5 NM_001277962:c.-427C>T STIM1
chr11 3855884 rs3061890 STIM1 UTR5 NM_001277961:c.-387_-383del-,NM_001277962:c.- STIM1
chr1 3856982 rs12145238 CEP104 UTR5 NM_014704:c.-4575T>G CEP104
chr1 3857024 rs7542369 CEP104 UTR5 NM_014704:c.-4617G>C CEP104
chr1 3857154 rs4648428 CEP104 UTR5 NM_014704:c.-4747T>C CEP104
chr1 3857566 rs34891610 DFFB UTR5 NM_001320136:c.-8197A>G DFFB
chr1 3857574 rs12723005 DFFB UTR5 NM_001320136:c.-8189T>C DFFB
chr12 3863956 rs12581274 PARP11 UTR5 NM_001286522:c.-34042G>A PARP11
chr12 3873309 rs12823996 PARP11 UTR5 NM_001286521:c.-43395G>A PARP11
chr12 3873316 rs66847009 PARP11 UTR5 NM_001286521:c.-43402G>A PARP11
chr12 3873365 rs570602708 PARP11 UTR5 NM_001286521:c.-43451A>G PARP11
chr1 3883916 rs7555538 DFFB UTR3 NM_001320136:c.*175G>T DFFB
chr1 3884524 rs141020982 DFFB UTR3 NM_001320136:c.*783C>T DFFB
chr1 3884577 rs45603135 DFFB UTR3 NM_001320136:c.*836T>G DFFB
chr1 3884683 rs10909817 DFFB UTR3 NM_001320136:c.*942T>G DFFB
chr1 3884756 rs45463695 DFFB UTR3 NM_001320136:c.*1015A>T DFFB
chr1 3889510 rs4075974 C1orf174 UTR3 NM_207356:c.*450C>T C1orf174
chr1 3889771 rs10797351 C1orf174 UTR3 NM_207356:c.*189C>A C1orf174
chr1 3889794 rs10909819 C1orf174 UTR3 NM_207356:c.*166A>G C1orf174
chr1 3900290 rs61770363 C1orf174 UTR5 NM_207356:c.-104C>T C1orf174
chr11 4091900 rs201649544 STIM1 UTR3 NM_001277962:c.*574T>C STIM1
chr11 4091970 rs3750996 STIM1 UTR3 NM_001277962:c.*644A>G STIM1
chr11 4092165 rs1561876 STIM1 UTR3 NM_001277962:c.*839G>A STIM1
chr11 4094744 rs12806698 RRM1 UTR5 NM_001318064:c.-12696C>A RRM1
chr11 4116109 rs2735690 RRM1 UTR5 NM_001318065:c.-5633T>C RRM1
chr11 4138534 rs1042919 RRM1 UTR3 NM_001318064:c.*151A>T RRM1
chr11 4138541 rs866902 RRM1 UTR3 NM_001033:c.*158delT RRM1
chr11 4138699 rs1042927 RRM1 UTR3 NM_001318064:c.*316C>A RRM1
chr12 4300045 rs369380641 CCND2 UTR3 NM_001759:c.*36A>C CCND2
chr12 4301353 rs200860740 CCND2 UTR3 NM_001759:c.*1344_*1345insTT CCND2
chr12 4302473 rs3217925 CCND2 UTR3 NM_001759:c.*2464C>T CCND2
chr12 4302517 rs3217926 CCND2 UTR3 NM_001759:c.*2508T>C CCND2
chr12 4302638 rs3217927 CCND2 UTR3 NM_001759:c.*2629G>A CCND2
chr12 4303834 rs3217933 CCND2 UTR3 NM_001759:c.*3825T>C CCND2
chr12 4304960 rs4765775 CCND2 UTR3 NM_001759:c.*4951G>A CCND2
chr12 4304979 rs67603280 CCND2 UTR3 NM_001759:c.*4970delT CCND2
chr12 4305001 rs796548117 CCND2 UTR3 NM_001759:c.*4992delT CCND2
chr12 4352803 rs79038609 TIGAR UTR3 NM_020375:c.*112T>A TIGAR
chr12 4352874 rs1046161 TIGAR UTR3 NM_020375:c.*183C>T TIGAR
chr12 4352980 rs1046164 TIGAR UTR3 NM_020375:c.*289G>A TIGAR
chr12 4353339 rs11063099 TIGAR UTR3 NM_020375:c.*648G>A TIGAR
chr12 4353432 rs17700406 TIGAR UTR3 NM_020375:c.*741T>C TIGAR
chr12 4353870 rs12823973 TIGAR UTR3 NM_020375:c.*1179G>T TIGAR
chr12 4354038 rs7962818 TIGAR UTR3 NM_020375:c.*1347C>T TIGAR
chr12 4355264 rs12422543 TIGAR UTR3 NM_020375:c.*2573T>C TIGAR
chr12 4355826 rs559051972 TIGAR UTR3 NM_020375:c.*3135A>G TIGAR
chr12 4356592 rs542913696 TIGAR UTR3 NM_020375:c.*3901C>A TIGAR
chr12 4356735 rs10735033 TIGAR UTR3 NM_020375:c.*4044T>C TIGAR
chr12 4357237 rs11063101 TIGAR UTR3 NM_020375:c.*4546A>T TIGAR
chr12 4357936 rs6489535 TIGAR UTR3 NM_020375:c.*5245C>T TIGAR
chr12 4358613 rs10849046 TIGAR UTR3 NM_020375:c.*5922A>G TIGAR
chr12 4359287 rs77818541 TIGAR UTR3 NM_020375:c.*6596G>A TIGAR
chr12 4359308 rs7976596 TIGAR UTR3 NM_020375:c.*6617A>G TIGAR
chr12 4359936 rs73050250 TIGAR UTR3 NM_020375:c.*7245G>A TIGAR
chr11 4367297 rs61885767 OR52B4 UTR3 NM_001005161:c.*54T>A OR52B4
chr11 4368357 rs7929171 OR52B4 UTR5 NM_001005161:c.-62C>G OR52B4
chr12 4368914 rs11063112 FGF23 UTR3 NM_020638:c.*1429A>T FGF23
chr12 4370320 rs13312794 FGF23 UTR3 NM_020638:c.*23T>G FGF23
chr11 4385245 rs201359489 TRIM21 UTR3 NM_003141:c.*40G>A TRIM21
chr11 4385249 rs4144331 TRIM21 UTR3 NM_003141:c.*36C>A TRIM21
chr11 4385253 rs2269330 TRIM21 UTR3 NM_003141:c.*32T>C TRIM21
chr11 4393643 rs1426378 TRIM21 UTR5 NM_003141:c.-3234C>T TRIM21
chr12 4487812 rs7793 C12orf4 UTR3 NM_001346155:c.*1995A>G C12orf4
chr12 4488579 rs11063205 C12orf4 UTR3 NM_001346155:c.*1228C>T C12orf4
chr12 4489379 rs558323807 C12orf4 UTR3 NM_001346155:c.*428A>C C12orf4
chr12 4559058 rs141884148 RAD51AP1 UTR3 NM_006479:c.*65T>G RAD51AP1
chr12 4559696 rs7962720 RAD51AP1 UTR3 NM_006479:c.*703C>T RAD51AP1
chr11 4599098 rs12796784 TRIM68 UTR3 NM_001304496:c.*1178A>G TRIM68
chr11 4599136 rs12796973 TRIM68 UTR3 NM_001304496:c.*1140A>G TRIM68
chr11 4599321 rs4910636 TRIM68 UTR3 NM_001304496:c.*955A>G TRIM68
chr11 4599324 rs747403493 TRIM68 UTR3 NM_001304496:c.*952C>T TRIM68
chr11 4599483 rs4910637 TRIM68 UTR3 NM_001304496:c.*793A>G TRIM68
chr11 4599631 rs4910638 TRIM68 UTR3 NM_001304496:c.*645G>T TRIM68
chr11 4600093 rs3750992 TRIM68 UTR3 NM_001304496:c.*183A>C TRIM68
chr11 4600255 rs2231978 TRIM68 UTR3 NM_001304496:c.*21G>C TRIM68
chr12 4604869 rs17774188 DYRK4 UTR5 NM_001282285:c.-122G>A DYRK4
chr11 4608214 rs6578503 TRIM68 UTR5 NM_001304496:c.-5949T>C TRIM68
chr12 4613888 rs61909659 DYRK4 UTR3 NM_003845:c.*135A>G DYRK4
chr12 4649022 rs714621 AKAP3 UTR5 NM_006422:c.-10826C>G AKAP3
chr11 4653928 rs721758 OR51E1 UTR3 NM_152430:c.*445G>A OR51E1
chr11 4654554 rs12282802 OR51E1 UTR3 NM_152430:c.*1071A>T OR51E1
chr11 4654616 rs12276018 OR51E1 UTR3 NM_152430:c.*1133C>G OR51E1
chr11 4654729 rs12282863 OR51E1 UTR3 NM_152430:c.*1246A>G OR51E1
chr11 4655168 rs1055262 OR51E1 UTR3 NM_152430:c.*1685C>G OR51E1
chr11 4655185 rs12418927 OR51E1 UTR3 NM_152430:c.*1702G>A OR51E1
chr11 4655227 rs1472229 OR51E1 UTR3 NM_152430:c.*1744G>A OR51E1
chr1 4655398 rs201338434 AJAP1 UTR5 NM_018836:c.-28C>T AJAP1
chr11 4680280 rs1685 OR51E2 UTR3 NM_030774:c.*1469A>G OR51E2
chr11 4680878 rs11033308 OR51E2 UTR3 NM_030774:c.*871G>A OR51E2
chr11 4680986 rs149849445 OR51E2 UTR3 NM_030774:c.*763T>C OR51E2
chr11 4681033 rs7112353 OR51E2 UTR3 NM_030774:c.*716C>G OR51E2
chr11 4681608 rs73388885 OR51E2 UTR3 NM_030774:c.*141C>T OR51E2
chr12 4687263 rs182957670 NDUFA9 UTR3 NM_005002:c.*155A>G NDUFA9
chr12 4772600 rs2286581 GALNT8 UTR3 NM_017417:c.*3C>T GALNT8
chr12 4772609 rs2286582 GALNT8 UTR3 NM_017417:c.*12T>C GALNT8
chr1 4774546 rs389959 AJAP1 UTR3 NM_018836:c.*47T>C AJAP1
chr1 4777597 rs140407981 AJAP1 UTR3 NM_001042478:c.*256G>A AJAP1
chr1 4782920 rs12406384 AJAP1 UTR3 NM_018836:c.*435C>T AJAP1
chr1 4782921 rs12074406 AJAP1 UTR3 NM_018836:c.*436G>A AJAP1
chr1 4783246 rs41311394 AJAP1 UTR3 NM_018836:c.*761C>T AJAP1
chr1 4783471 rs9426505 AJAP1 UTR3 NM_018836:c.*986G>A AJAP1
chr12 4809744 rs758533 KCNA6 UTR5 NM_002235:c.-298A>G KCNA6
chr12 4809921 rs574421026 KCNA6 UTR5 NM_002235:c.-121G>C KCNA6
chr12 4809957 rs543420698 KCNA6 UTR5 NM_002235:c.-85C>G KCNA6
chr12 4812062 rs2239503 KCNA6 UTR3 NM_002235:c.*431T>C KCNA6
chr12 4812135 rs2239504 KCNA6 UTR3 NM_002235:c.*504T>C KCNA6
chr12 4812523 rs2239505 KCNA6 UTR3 NM_002235:c.*892C>T KCNA6
chr12 4812616 rs2239506 KCNA6 UTR3 NM_002235:c.*985C>G KCNA6
chr12 4812864 rs3319 KCNA6 UTR3 NM_002235:c.*1233C>G KCNA6
chr12 4813125 rs150346165 KCNA6 UTR3 NM_002235:c.*1494_*1495insT KCNA6
chr12 4813136 rs184169074 KCNA6 UTR3 NM_002235:c.*1505A>T KCNA6
chr12 4813568 rs7303721 KCNA6 UTR3 NM_002235:c.*1937A>G KCNA6
chr12 4813883 rs7310372 KCNA6 UTR3 NM_002235:c.*2252T>C KCNA6
chr10 4826253 rs2924275 AKR1E2 UTR5 NM_001271021:c.-72G>T AKR1E2
chr10 4847538 rs12767539 AKR1E2 UTR3 NM_001271021:c.*8T>A AKR1E2
chr10 4847540 rs74111762 AKR1E2 UTR3 NM_001271021:c.*10C>T AKR1E2
chr10 4847578 rs1869214 AKR1E2 UTR3 NM_001271021:c.*48T>C AKR1E2
chr10 4847614 rs12569410 AKR1E2 UTR3 NM_001271021:c.*84C>T AKR1E2
chr12 4850738 rs397775774 KCNA6 UTR3 NM_002235:c.*3148_*3149insA KCNA6
chr12 4850821 rs10774276 KCNA6 UTR3 NM_002235:c.*3231C>T KCNA6
chr12 4850827 rs3168377 KCNA6 UTR3 NM_002235:c.*3237C>A KCNA6
chr12 4850857 rs14054 KCNA6 UTR3 NM_002235:c.*3267C>A KCNA6
chr12 4850923 rs700480 KCNA6 UTR3 NM_002235:c.*3333T>C KCNA6
chr12 4850951 rs12336 KCNA6 UTR3 NM_002235:c.*3361T>C KCNA6
chr12 4911245 rs12817318 KCNA1 UTR5 NM_000217:c.-134G>T KCNA1
chr12 4911269 rs35678382 KCNA1 UTR5 NM_000217:c.-110G>A KCNA1
chr12 4912875 rs4766310 KCNA1 UTR3 NM_000217:c.*9G>A KCNA1
chr12 4913272 rs4766311 KCNA1 UTR3 NM_000217:c.*406C>T KCNA1
chr12 4914547 rs7974459 KCNA1 UTR3 NM_000217:c.*1681T>C KCNA1
chr12 4914793 rs7974559 KCNA1 UTR3 NM_000217:c.*1927A>T KCNA1
chr12 4915462 rs188377239 KCNA1 UTR3 NM_000217:c.*2596A>T KCNA1
chr12 4915928 rs10849174 KCNA1 UTR3 NM_000217:c.*3062T>C KCNA1
chr10 4963357 rs7069696 AKR1C1 UTR5 NM_001353:c.-88G>C AKR1C1
chr10 4977767 rs8483 AKR1C1 UTR3 NM_001353:c.*25G>A AKR1C1
chr10 4977782 rs35289491 AKR1C1 UTR3 NM_001353:c.*40G>A AKR1C1
chr10 4977796 rs35763015 AKR1C1 UTR3 NM_001353:c.*54A>C AKR1C1
chr10 4977811 rs548442452 AKR1C1 UTR3 NM_001353:c.*69A>G AKR1C1
chr10 4977822 rs373334884 AKR1C1 UTR3 NM_001353:c.*80T>C AKR1C1
chr10 4988075 rs11252866 AKR1C2 UTR3 NM_001354:c.*1921G>A AKR1C2
chr10 4988334 rs4526684 AKR1C2 UTR3 NM_001354:c.*1662C>T AKR1C2
chr10 4988341 rs4584482 AKR1C2 UTR3 NM_001354:c.*1655A>G AKR1C2
chr10 4988427 rs71391984 AKR1C2 UTR3 NM_001354:c.*1569delA,NM_205845:c.*1569delA AKR1C2
chr10 4988668 rs61854352 AKR1C2 UTR3 NM_001354:c.*1328T>C AKR1C2
chr10 4989168 rs4523595 AKR1C2 UTR3 NM_001354:c.*828C>A AKR1C2
chr10 4989685 rs10904383 AKR1C2 UTR3 NM_001354:c.*311G>A AKR1C2
chr10 4989823 rs113349934 AKR1C2 UTR3 NM_001354:c.*173G>A AKR1C2
chr10 5000102 rs12764498 AKR1C2 UTR3 NM_001135241:c.*308A>G AKR1C2
chr10 5003911 rs534532528 AKR1C2 UTR5 NM_001354:c.-76A>G AKR1C2
chr10 5007460 rs11252880 AKR1C2 UTR5 NM_001354:c.-3625C>T AKR1C2
chr12 5043981 rs3741930 KCNA5 UTR5 NM_002234:c.-167C>T KCNA5
chr10 5048785 rs573411363 AKR1C3 UTR5 NM_001253908:c.-27C>T AKR1C3
chr11 5070652 rs4144717 OR52E1 UTR3 NM_001348221:c.*155A>G OR52E1
chr10 5097623 rs2245191 AKR1C3 UTR3 NM_001253909:c.*25C>A AKR1C3
chr10 5097694 rs2298305 AKR1C3 UTR3 NM_001253909:c.*96C>A AKR1C3
chr10 5098067 rs7076063 AKR1C3 UTR3 NM_001253909:c.*469A>G AKR1C3
chr10 5107511 rs3209896 AKR1C3 UTR3 NM_001253908:c.*8G>A AKR1C3
chr10 5107564 rs374107060 AKR1C3 UTR3 NM_001253908:c.*61C>G AKR1C3
chr10 5218824 rs141695403 AKR1C4 UTR3 NM_001818:c.*64_*65delTC AKR1C4
chr10 5218849 rs2398157 AKR1C4 UTR3 NM_001818:c.*89A>G AKR1C4
chr10 5218896 rs17307359 AKR1C4 UTR3 NM_001818:c.*136T>C AKR1C4
chr11 5225528 rs866134778 HBB UTR3 NM_000518:c.*70G>A HBB
chr11 5225550 rs759337708 HBB UTR3 NM_000518:c.*48T>C HBB
chr11 5227031 rs747545656 HBB UTR5 NM_000518:c.-10A>G HBB
chr11 5234463 rs777487918 HBD UTR5 NM_000519:c.-30A>G HBD
chr11 5234551 rs549964658 HBD UTR5 NM_000519:c.-118C>T HBD
chr11 5248304 rs869137375 HBG1 UTR3 NM_000559:c.*55delA HBG1
chr11 5248353 rs757054403 HBG1 UTR3 NM_000559:c.*6delC HBG1
chr11 5248354 rs1065686 HBG1 UTR3 NM_000559:c.*5A>T HBG1
chr11 5248356 rs377766148 HBG1 UTR3 NM_000559:c.*2_*3insC HBG1
chr11 5253222 rs34879481 HBG2 UTR3 NM_000184:c.*54_*55insA HBG2
chr11 5323322 rs7934105 OR51B2 UTR3 NM_033180:c.*37G>A OR51B2
chr11 5323331 rs7933257 OR51B2 UTR3 NM_033180:c.*28C>T OR51B2
chr11 5343546 rs78253695 OR51B5 UTR5 NM_001005567:c.-23_-22insGAC OR51B5
chr11 5345810 rs11036925 OR51B5 UTR5 NM_001005567:c.-2286A>T OR51B5
chr11 5345858 rs375718068 OR51B5 UTR5 NM_001005567:c.-2335_-2334insTTTTTTATTCCTTGAC OR51B5
chr11 5346339 rs10837868 OR51B5 UTR5 NM_001005567:c.-2815G>A OR51B5
chr10 5374239 rs10904482 UCN3 UTR3 NM_053049:c.*33G>A UCN3
chr10 5374602 rs7903714 UCN3 UTR3 NM_053049:c.*396T>G UCN3
chr11 5390382 rs376030473 OR51M1 UTR3 NM_001004756:c.*3C>G OR51M1
chr10 5393218 rs3255 TUBAL3 UTR3 NM_001171864:c.*299G>A TUBAL3
chr11 5402409 rs2647584 OR51J1 UTR5 NM_001348224:c.-188C>A OR51J1
chr11 5402529 rs79081522 OR51J1 UTR5 NM_001348224:c.-68T>C OR51J1
chr11 5402534 rs574315979 OR51J1 UTR5 NM_001348224:c.-63T>C OR51J1
chr11 5402545 rs7481498 OR51J1 UTR5 NM_001348224:c.-52G>A OR51J1
chr11 5402549 rs2736527 OR51J1 UTR5 NM_001348224:c.-48G>A OR51J1
chr11 5403608 rs2736525 OR51J1 UTR3 NM_001348224:c.*61T>A OR51J1
chr11 5403631 rs2647581 OR51J1 UTR3 NM_001348224:c.*84G>A OR51J1
chr11 5441528 rs540758844 OR51I1 UTR5 NM_001005288:c.-14T>C OR51I1
chr10 5446601 rs572914109 NET1 UTR5 NM_005863:c.-165C>T NET1
chr10 5446617 rs7090012 NET1 UTR5 NM_005863:c.-149C>G NET1
chr10 5446699 rs11558827 NET1 UTR5 NM_005863:c.-67A>G NET1
chr10 5457210 rs11791 NET1 UTR3 NM_001047160:c.*216A>G NET1
chr10 5457450 rs117204087 NET1 UTR3 NM_001047160:c.*456G>C NET1
chr10 5457742 rs6601972 NET1 UTR3 NM_001047160:c.*748A>T NET1
chr10 5458196 rs7087584 NET1 UTR3 NM_001047160:c.*1202C>G NET1
chr11 5489698 rs392296 OR52D1 UTR3 NM_001005163:c.*35G>A OR52D1
chr10 5498844 rs563290589 CALML5 UTR3 NM_017422:c.*154C>T CALML5
chr10 5498979 rs57631224 CALML5 UTR3 NM_017422:c.*19C>G CALML5
chr11 5507323 rs568912021 UBQLN3 UTR3 NM_017481:c.*268A>G UBQLN3
chr11 5507403 rs1060574 UBQLN3 UTR3 NM_017481:c.*188G>A UBQLN3
chr11 5516550 rs1809862 UBQLNL UTR5 NM_145053:c.-109G>T UBQLNL
chr11 5596666 rs10838406 TRIM6;TRIM6-TRIM34 UTR5 NM_001198644:c.-8677A>G TRIM6;TRIM6-TRIM34
chr11 5596757 rs12272467 TRIM6;TRIM6-TRIM34 UTR5 NM_001198644:c.-8586G>A TRIM6;TRIM6-TRIM34
chr11 5611451 rs72882004 TRIM6 UTR3 NM_058166:c.*109T>C TRIM6
chr11 5611484 rs149459566 TRIM6 UTR3 NM_058166:c.*142C>T TRIM6
chr11 5611498 rs555934533 TRIM6 UTR3 NM_058166:c.*156G>A TRIM6
chr11 5611510 rs375969165 TRIM6 UTR3 NM_058166:c.*168C>G TRIM6
chr11 5611769 rs535785196 TRIM6 UTR3 NM_058166:c.*427_*428delAC,NM_001198645:c.*42 TRIM6
chr11 5612415 rs71468041 TRIM6 UTR3 NM_058166:c.*1073delA,NM_001198645:c.*1073del TRIM6
chr10 5638879 rs2386649 ASB13 UTR3 NM_024701:c.*1824G>A ASB13
chr10 5638921 rs1132305 ASB13 UTR3 NM_024701:c.*1782C>T ASB13
chr10 5638933 rs1573 ASB13 UTR3 NM_024701:c.*1770T>C ASB13
chr10 5639069 rs76511142 ASB13 UTR3 NM_024701:c.*1634C>T ASB13
chr10 5639075 rs1132293 ASB13 UTR3 NM_024701:c.*1628G>A ASB13
chr10 5639210 rs141053750 ASB13 UTR3 NM_024701:c.*1493G>A ASB13
chr10 5639385 rs7901492 ASB13 UTR3 NM_024701:c.*1318A>G ASB13
chr10 5639427 rs7908974 ASB13 UTR3 NM_024701:c.*1276T>C ASB13
chr10 5639820 rs11256474 ASB13 UTR3 NM_024701:c.*883G>A ASB13
chr10 5640107 rs3750645 ASB13 UTR3 NM_024701:c.*596G>A ASB13
chr10 5640172 rs79839285 ASB13 UTR3 NM_024701:c.*531G>C ASB13
chr10 5640341 rs12414278 ASB13 UTR3 NM_024701:c.*362G>C ASB13
chr10 5640484 rs3750644 ASB13 UTR3 NM_024701:c.*219G>A ASB13
chr10 5640617 rs572095270 ASB13 UTR3 NM_024701:c.*86G>T ASB13
chr10 5640651 rs3750643 ASB13 UTR3 NM_024701:c.*52C>T ASB13
chr10 5640678 rs7896492 ASB13 UTR3 NM_024701:c.*25G>A ASB13
chr11 5643744 rs7109861 TRIM34;TRIM6-TRIM34 UTR3 NM_001003827:c.*35T>C TRIM34;TRIM6-TRIM34
chr11 5643995 rs7106798 TRIM34;TRIM6-TRIM34 UTR3 NM_001003827:c.*286A>G TRIM34;TRIM6-TRIM34
chr11 5663545 rs1566282 TRIM5 UTR3 NM_033092:c.*1962T>C TRIM5
chr11 5663657 rs6578672 TRIM5 UTR3 NM_033092:c.*1850T>C TRIM5
chr11 5664201 rs58997106 TRIM5 UTR3 NM_033092:c.*1305_*1306insT,NM_033034:c.*607_ TRIM5
chr11 5664202 rs757333650 TRIM5 UTR3 NM_033092:c.*1305delT,NM_033034:c.*607delT TRIM5
chr11 5680179 rs3824949 TRIM5 UTR5 NM_033092:c.-2C>G TRIM5
chr10 5684858 rs11259192 FAM208B UTR5 NM_001321783:c.-35785G>A FAM208B
chr10 5684874 rs7900687 FAM208B UTR5 NM_001321783:c.-35769G>A FAM208B
chr11 5685081 rs3802980 TRIM5 UTR5 NM_033092:c.-4904T>C TRIM5
chr11 5689666 rs2291841 TRIM22 UTR5 NM_006074:c.-6567A>C TRIM22
chr11 5709684 rs73404243 TRIM22 UTR3 NM_006074:c.*36C>T TRIM22
chr11 5710225 rs7113258 TRIM22 UTR3 NM_006074:c.*577T>A TRIM22
chr11 5710797 rs12417849 TRIM22 UTR3 NM_006074:c.*1149C>T TRIM22
chr11 5710798 rs12419560 TRIM22 UTR3 NM_006074:c.*1150T>A TRIM22
chr10 5763125 rs79427500 FAM208B UTR3 NM_017782:c.*93_*94delAC FAM208B
chr10 5765558 rs7770 GDI2 UTR3 NM_001494:c.*448A>G GDI2
chr10 5765645 rs2497 GDI2 UTR3 NM_001494:c.*361T>C GDI2
chr10 5765768 rs397770049 GDI2 UTR3 NM_001494:c.*237_*238insT,NM_001115156:c.*237 GDI2
chr11 5778646 rs75755747 OR52N5 UTR5 NM_001001922:c.-12T>C OR52N5
chr10 5813262 rs3736460 GDI2 UTR5 NM_001494:c.-4C>T GDI2
chr10 5813440 rs3736461 GDI2 UTR5 NM_001494:c.-182C>G GDI2
chr10 5861754 rs11255602 ANKRD16 UTR3 NM_019046:c.*971A>T ANKRD16
chr10 5862385 rs145857114 ANKRD16 UTR3 NM_019046:c.*340T>C ANKRD16
chr10 5890224 rs2253422 FBXO18 UTR5 NM_001258453:c.-15878C>A FBXO18
chr10 5890237 rs145906182 FBXO18 UTR5 NM_001258453:c.-15865C>A FBXO18
chr10 5894462 rs12781700 FBXO18 UTR5 NM_032807:c.-28C>G FBXO18
chr10 5937518 rs796296602 FBXO18 UTR3 NM_001258452:c.*238delA,NM_178150:c.*238delA, FBXO18
chr10 5937534 rs2387091 FBXO18 UTR3 NM_001258452:c.*254A>T FBXO18
chr12 5945229 rs6489680 ANO2 UTR5 NM_001278596:c.-12T>C ANO2
chr10 5952731 rs2296135 IL15RA UTR3 NM_172200:c.*364T>G IL15RA
chr10 5953007 rs186658799 IL15RA UTR3 NM_172200:c.*88G>A IL15RA
chr10 5953089 rs2229135 IL15RA UTR3 NM_172200:c.*6G>A IL15RA
chr10 5953242 rs529714452 IL15RA UTR3 NM_001351096:c.*18C>T IL15RA
chr10 5968664 rs8177676 IL15RA UTR5 NM_001351096:c.-2345A>T IL15RA
chr10 5977992 rs4749858 IL15RA UTR5 NM_001243539:c.-11673G>C IL15RA
chr10 5978138 rs2387089 IL15RA UTR5 NM_001243539:c.-11819G>C IL15RA
chr11 5985914 rs112071357 OR52L1 UTR3 NM_001005173:c.*27C>T OR52L1
chr1 5992498 rs528566414 KCNAB2 UTR5 NM_001199861:c.-48071A>G KCNAB2
chr1 5992521 rs806109 KCNAB2 UTR5 NM_001199861:c.-48048G>A KCNAB2
chr10 6011095 rs542143897 IL2RA UTR3 NM_000417:c.*1777G>A IL2RA
chr10 6011411 rs12244380 IL2RA UTR3 NM_000417:c.*1461T>C IL2RA
chr10 6011605 rs1570538 IL2RA UTR3 NM_000417:c.*1267G>A IL2RA
chr10 6012802 rs12722600 IL2RA UTR3 NM_000417:c.*70G>A IL2RA
chr1 6034391 rs796290761 KCNAB2 UTR5 NM_001199860:c.-6178del- KCNAB2
chr1 6034534 rs1295095 KCNAB2 UTR5 NM_001199860:c.-6035T>G KCNAB2
chr1 6034740 rs12076209 KCNAB2 UTR5 NM_001199860:c.-5829G>A KCNAB2
chr1 6034751 rs11584686 KCNAB2 UTR5 NM_001199860:c.-5818C>T KCNAB2
chr10 6089079 rs140764661 RBM17 UTR5 NM_032905:c.-7987A>G RBM17
chr10 6089349 rs76943221 RBM17 UTR5 NM_001145547:c.-7717C>A RBM17
chr10 6089423 rs12261535 RBM17 UTR5 NM_001145547:c.-7643T>G RBM17
chr10 6089448 rs78296807 RBM17 UTR5 NM_001145547:c.-7618_-7617insTCC RBM17
chr10 6089457 rs535541293 RBM17 UTR5 NM_001145547:c.-7609C>G RBM17
chr10 6089664 rs4749964 RBM17 UTR5 NM_001145547:c.-7402T>C RBM17
chr10 6089912 rs12219946 RBM17 UTR5 NM_001145547:c.-7154A>G RBM17
chr10 6089929 rs61839683 RBM17 UTR5 NM_001145547:c.-7137C>G RBM17
chr1 6098972 rs4908772 KCNAB2 UTR3 NM_001199861:c.*398A>G KCNAB2
chr1 6100055 rs34324678 KCNAB2 UTR3 NM_001199861:c.*1481G>A KCNAB2
chr1 6100503 rs9434641 KCNAB2 UTR3 NM_001199861:c.*1929A>G KCNAB2
chr1 6100549 rs3789528 KCNAB2 UTR3 NM_001199861:c.*1975C>T KCNAB2
chr1 6100632 rs60141764 KCNAB2 UTR3 NM_001199861:c.*2058_*2059insC,NM_172130:c.*2 KCNAB2
chr1 6100638 rs11542388 KCNAB2 UTR3 NM_001199861:c.*2064A>G KCNAB2
chr1 6100810 rs3789527 KCNAB2 UTR3 NM_001199861:c.*2236G>A KCNAB2
chr1 6100816 rs1056860 KCNAB2 UTR3 NM_001199861:c.*2242A>G KCNAB2
chr1 6100898 rs538 KCNAB2 UTR3 NM_001199861:c.*2324A>G KCNAB2
chr1 6101031 rs75384095 KCNAB2 UTR3 NM_001199861:c.*2457_*2458insT,NM_172130:c.*2 KCNAB2
chr1 6101040 rs78653623 KCNAB2 UTR3 NM_001199861:c.*2466T>A KCNAB2
chr1 6101899 rs12758341 CHD5 UTR3 NM_015557:c.*3575C>T CHD5
chr1 6101994 rs6696489 CHD5 UTR3 NM_015557:c.*3480A>G CHD5
chr1 6102169 rs138682656 CHD5 UTR3 NM_015557:c.*3305T>C CHD5
chr1 6102191 rs780789629 CHD5 UTR3 NM_015557:c.*3283_*3282delGT CHD5
chr1 6102295 rs28540861 CHD5 UTR3 NM_015557:c.*3179T>A CHD5
chr1 6102347 rs3827728 CHD5 UTR3 NM_015557:c.*3127T>C CHD5
chr1 6102523 rs3810993 CHD5 UTR3 NM_015557:c.*2951C>T CHD5
chr1 6102541 rs3810992 CHD5 UTR3 NM_015557:c.*2933A>G CHD5
chr1 6103865 rs3810989 CHD5 UTR3 NM_015557:c.*1609G>A CHD5
chr1 6103969 rs3810988 CHD5 UTR3 NM_015557:c.*1505G>A CHD5
chr1 6104490 rs527366841 CHD5 UTR3 NM_015557:c.*983_*984insCC CHD5
chr1 6104611 rs745759 CHD5 UTR3 NM_015557:c.*863T>C CHD5
chr1 6104619 rs748210937 CHD5 UTR3 NM_015557:c.*855delG CHD5
chr1 6104619 rs3888071 CHD5 UTR3 NM_015557:c.*855G>C CHD5
chr1 6104620 rs745758 CHD5 UTR3 NM_015557:c.*854G>T CHD5
chr1 6104852 rs45512194 CHD5 UTR3 NM_015557:c.*622C>G CHD5
chr1 6105349 rs567662166 CHD5 UTR3 NM_015557:c.*125G>A CHD5
chr1 6105359 rs1883768 CHD5 UTR3 NM_015557:c.*115G>A CHD5
chr10 6115873 rs773128668 RBM17 UTR3 NM_032905:c.*317_*319delAAA,NM_001145547:c.*3 RBM17
chr10 6146375 rs7074082 PFKFB3 UTR5 NM_001282630:c.-4A>G PFKFB3
chr12 6200432 rs11539945 CD9 UTR5 NM_001769:c.-68C>T CD9
chr10 6202956 rs617245 PFKFB3 UTR5 NM_001314063:c.-305A>G PFKFB3
chr10 6203211 rs202167699 PFKFB3 UTR5 NM_001314063:c.-50G>A PFKFB3
chr10 6203215 rs558760497 PFKFB3 UTR5 NM_001314063:c.-46C>T PFKFB3
chr11 6211423 rs9659 FAM160A2 UTR3 NM_032127:c.*83G>A FAM160A2
chr11 6211489 rs757507679 FAM160A2 UTR3 NM_032127:c.*17A>G FAM160A2
chr1 6219556 rs11121500 RNF207 UTR3 NM_207396:c.*149A>G RNF207
chr1 6219718 rs4908866 RNF207 UTR3 NM_207396:c.*311G>T RNF207
chr1 6220812 rs41278922 RNF207 UTR3 NM_207396:c.*1405G>C RNF207
chr1 6221732 rs58443742 ICMT UTR3 NM_012405:c.*3348G>A ICMT
chr1 6223002 rs12070839 ICMT UTR3 NM_012405:c.*2078G>T ICMT
chr1 6223079 rs532182070 ICMT UTR3 NM_012405:c.*2001G>A ICMT
chr1 6223354 rs188831706 ICMT UTR3 NM_012405:c.*1726C>T ICMT
chr1 6223600 rs543662466 ICMT UTR3 NM_012405:c.*1480G>A ICMT
chr1 6224620 rs1802353 ICMT UTR3 NM_012405:c.*460G>A ICMT
chr10 6233110 rs370060304 PFKFB3 UTR3 NM_001323016:c.*209C>T PFKFB3
chr10 6233172 rs41291285 PFKFB3 UTR3 NM_001323016:c.*271C>T PFKFB3
chr10 6233182 rs1539232 PFKFB3 UTR3 NM_001323016:c.*281T>C PFKFB3
chr10 6233260 rs1539233 PFKFB3 UTR3 NM_001323016:c.*359G>A PFKFB3
chr10 6233639 rs3750667 PFKFB3 UTR3 NM_001323016:c.*738C>T PFKFB3
chr10 6233804 rs576292121 PFKFB3 UTR3 NM_001323016:c.*903C>T PFKFB3
chr10 6233813 rs55643411 PFKFB3 UTR3 NM_001323016:c.*912T>C PFKFB3
chr10 6234611 rs1064891 PFKFB3 UTR3 NM_001323016:c.*1710T>C PFKFB3
chr10 6234780 rs1539234 PFKFB3 UTR3 NM_001323016:c.*1879G>A PFKFB3
chr10 6235022 rs746211569 PFKFB3 UTR3 NM_001323016:c.*2121C>T PFKFB3
chr1 6247570 rs1043971 GPR153 UTR3 NM_207370:c.*1768C>T GPR153
chr1 6248635 rs12744452 GPR153 UTR3 NM_207370:c.*703T>C GPR153
chr1 6248864 rs369336095 GPR153 UTR3 NM_207370:c.*474delG GPR153
chr1 6248870 rs190745061 GPR153 UTR3 NM_207370:c.*468G>C GPR153
chr1 6249259 rs1883608 GPR153 UTR3 NM_207370:c.*79G>C GPR153
chr1 6254915 rs747871193 GPR153 UTR5 NM_207370:c.-10G>A GPR153
chr1 6254972 rs544609788 GPR153 UTR5 NM_207370:c.-67G>T GPR153
chr11 6259878 rs2929180 CCKBR UTR5 NM_176875:c.-51T>G CCKBR
chr1 6264553 rs117748074 ACOT7 UTR3 NM_007274:c.*44G>A ACOT7
chr11 6271607 rs10839535 CCKBR UTR3 NM_176875:c.*64C>G CCKBR
chr11 6271608 rs10839536 CCKBR UTR3 NM_176875:c.*65G>A CCKBR
chr11 6271667 rs201080709 CCKBR UTR3 NM_176875:c.*124G>A CCKBR
chr11 6271920 rs7944010 CCKBR UTR3 NM_176875:c.*377T>C CCKBR
chr11 6271952 rs1042047 CCKBR UTR3 NM_176875:c.*409A>C CCKBR
chr11 6271980 rs1042048 CCKBR UTR3 NM_176875:c.*437A>G CCKBR
chr12 6310980 rs749929 PLEKHG6 UTR5 NM_001144856:c.-1247C>A PLEKHG6
chr12 6312213 rs115425082 PLEKHG6 UTR5 NM_018173:c.-14C>T PLEKHG6
chr12 6312682 rs2286718 PLEKHG6 UTR5 NM_001144857:c.-463C>T PLEKHG6
chr12 6313106 rs10849440 PLEKHG6 UTR5 NM_001144857:c.-39T>C PLEKHG6
chr12 6328216 rs4149652 PLEKHG6 UTR3 NM_018173:c.*71C>T PLEKHG6
chr12 6328223 rs4149651 PLEKHG6 UTR3 NM_018173:c.*78T>C PLEKHG6
chr12 6341888 rs200084924 TNFRSF1A UTR5 NM_001065:c.-74G>A TNFRSF1A
chr12 6375500 rs13306617 LTBR UTR5 NM_001270987:c.-56C>G LTBR
chr12 6375519 rs545108113 LTBR;SCNN1A UTR5 NM_001270987:c.-37G>A LTBR;SCNN1A
chr12 6375543 rs10849447 LTBR;SCNN1A UTR5 NM_001270987:c.-13T>C LTBR;SCNN1A
chr12 6375647 rs72645140 SCNN1A UTR5 NM_001038:c.-864C>T SCNN1A
chr12 6384185 rs10849448 LTBR UTR5 NM_002342:c.-174A>G LTBR
chr1 6385694 rs549941128 ACOT7 UTR5 NM_181864:c.-28G>A ACOT7
chr12 6390939 rs12354 LTBR UTR3 NM_001270987:c.*2T>G LTBR
chr1 6393460 rs76483502 ACOT7 UTR5 NM_007274:c.-62_-61insC ACOT7
chr1 6393650 rs58110988 ACOT7 UTR5 NM_007274:c.-251A>C ACOT7
chr11 6394652 rs8164 SMPD1 UTR3 NM_001318088:c.*45G>A SMPD1
chr11 6405441 rs377143617 APBB1 UTR5 NM_001257320:c.-1675G>A APBB1
chr1 6415284 rs549341887 HES2 UTR3 NM_019089:c.*3588_*3589insT HES2
chr1 6415626 rs11364 HES2 UTR3 NM_019089:c.*3247G>A HES2
chr1 6416056 rs4908889 HES2 UTR3 NM_019089:c.*2817T>C HES2
chr1 6416432 rs78326109 HES2 UTR3 NM_019089:c.*2441G>C HES2
chr1 6419865 rs112408380 HES2 UTR5 NM_019089:c.-45T>A HES2
chr1 6419878 rs12074131 HES2 UTR5 NM_019089:c.-58T>C HES2
chr10 6427147 rs758262194 PRKCQ UTR3 NM_006257:c.*1059_*1060insA,NM_001242413:c.*1 PRKCQ
chr10 6427193 rs582052 PRKCQ UTR3 NM_001282644:c.*1014C>A PRKCQ